Incidental Mutation 'R5157:Lsr'
ID396778
Institutional Source Beutler Lab
Gene Symbol Lsr
Ensembl Gene ENSMUSG00000001247
Gene Namelipolysis stimulated lipoprotein receptor
SynonymsLisch7, ILDR3
MMRRC Submission 042739-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5157 (G1)
Quality Score219
Status Validated
Chromosome7
Chromosomal Location30957770-30973464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30966040 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 163 (Y163C)
Ref Sequence ENSEMBL: ENSMUSP00000146120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001279] [ENSMUST00000098553] [ENSMUST00000108116] [ENSMUST00000147431] [ENSMUST00000205961]
Predicted Effect probably damaging
Transcript: ENSMUST00000001279
AA Change: Y163C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000001279
Gene: ENSMUSG00000001247
AA Change: Y163C

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
Pfam:LSR 206 253 9.6e-27 PFAM
low complexity region 280 296 N/A INTRINSIC
low complexity region 445 464 N/A INTRINSIC
low complexity region 468 487 N/A INTRINSIC
low complexity region 496 513 N/A INTRINSIC
low complexity region 544 558 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098553
AA Change: Y163C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096153
Gene: ENSMUSG00000001247
AA Change: Y163C

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
low complexity region 212 228 N/A INTRINSIC
low complexity region 377 396 N/A INTRINSIC
low complexity region 400 419 N/A INTRINSIC
low complexity region 428 445 N/A INTRINSIC
low complexity region 476 490 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108116
AA Change: Y163C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103751
Gene: ENSMUSG00000001247
AA Change: Y163C

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
Pfam:LSR 187 235 2.3e-25 PFAM
low complexity region 261 277 N/A INTRINSIC
low complexity region 426 445 N/A INTRINSIC
low complexity region 449 468 N/A INTRINSIC
low complexity region 477 494 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147431
SMART Domains Protein: ENSMUSP00000123487
Gene: ENSMUSG00000001247

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
low complexity region 253 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181395
Predicted Effect probably damaging
Transcript: ENSMUST00000205961
AA Change: Y163C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.45 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality during fetal growth and development, liver hypoplasia, and variable penetrance of pallor, hemorrhaging, superficial skin detachment, and reduced size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,686,066 S2T probably benign Het
Abca3 C T 17: 24,408,122 R1266C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 V670D probably damaging Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
AY074887 T C 9: 54,950,818 probably benign Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Catspere1 A T 1: 177,879,782 noncoding transcript Het
Cnmd T C 14: 79,656,686 Q87R probably benign Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Cyp2d26 T C 15: 82,790,989 Q388R probably benign Het
Ddb1 A T 19: 10,622,364 T646S probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Dzank1 T C 2: 144,483,412 H545R probably damaging Het
Ehhadh T A 16: 21,766,511 M207L probably benign Het
Elmo2 T A 2: 165,291,707 probably benign Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Igsf21 T C 4: 140,028,067 T426A possibly damaging Het
Kcnf1 T C 12: 17,174,741 E493G probably benign Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Map3k20 A T 2: 72,438,214 T522S probably benign Het
Mpp5 T A 12: 78,820,815 M324K possibly damaging Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Msln T C 17: 25,752,983 M87V probably benign Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr292 A G 7: 86,695,232 K259E probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 probably benign Het
Pprc1 G T 19: 46,064,758 probably benign Het
Ptprm T A 17: 66,957,097 K385I probably benign Het
Rfxap T A 3: 54,804,517 N215I probably damaging Het
Slc16a7 A T 10: 125,233,464 Y114* probably null Het
Smarcb1 G T 10: 75,911,794 probably benign Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Uba7 G A 9: 107,980,047 V703I probably benign Het
Upb1 T C 10: 75,412,804 S53P possibly damaging Het
Zfp672 A G 11: 58,316,851 S215P possibly damaging Het
Zfp978 T A 4: 147,390,980 L328H probably damaging Het
Other mutations in Lsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Lsr APN 7 30971996 missense probably damaging 1.00
IGL01893:Lsr APN 7 30962232 missense possibly damaging 0.90
IGL02557:Lsr APN 7 30958494 missense possibly damaging 0.90
IGL02800:Lsr APN 7 30958413 missense probably damaging 1.00
IGL03030:Lsr APN 7 30959281 missense possibly damaging 0.50
IGL03166:Lsr APN 7 30962097 critical splice donor site probably null
R0349:Lsr UTSW 7 30959273 missense probably damaging 1.00
R0513:Lsr UTSW 7 30958338 missense probably benign 0.01
R1226:Lsr UTSW 7 30971883 missense probably damaging 1.00
R1539:Lsr UTSW 7 30972092 missense possibly damaging 0.78
R2281:Lsr UTSW 7 30958345 missense probably damaging 1.00
R4208:Lsr UTSW 7 30973094 missense probably benign 0.00
R4422:Lsr UTSW 7 30965997 missense probably benign 0.08
R4544:Lsr UTSW 7 30971976 missense probably damaging 1.00
R4727:Lsr UTSW 7 30966040 missense probably damaging 1.00
R4791:Lsr UTSW 7 30958552 missense probably damaging 0.99
R4946:Lsr UTSW 7 30958209 missense probably benign 0.17
R5652:Lsr UTSW 7 30959031 missense probably damaging 1.00
R6052:Lsr UTSW 7 30958617 missense probably damaging 1.00
R6314:Lsr UTSW 7 30958599 missense probably damaging 1.00
R6566:Lsr UTSW 7 30972083 missense possibly damaging 0.92
R6917:Lsr UTSW 7 30958296 missense possibly damaging 0.94
X0050:Lsr UTSW 7 30972177 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGAGAAGCCCAAGTGAC -3'
(R):5'- CTGGATGAATGGTTTCACTTTAGC -3'

Sequencing Primer
(F):5'- AGCCCAAGTGACTGGCAGTG -3'
(R):5'- GTAGGTACTTGTCTGAAATCCCAGC -3'
Posted On2016-06-21