Incidental Mutation 'R5157:Olfr292'
ID396779
Institutional Source Beutler Lab
Gene Symbol Olfr292
Ensembl Gene ENSMUSG00000060688
Gene Nameolfactory receptor 292
SynonymsGA_x6K02T2NHDJ-9425121-9424195, MOR220-2
MMRRC Submission 042739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5157 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86688330-86697507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86695232 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 259 (K259E)
Ref Sequence ENSEMBL: ENSMUSP00000079060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080165]
Predicted Effect probably benign
Transcript: ENSMUST00000080165
AA Change: K259E

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000079060
Gene: ENSMUSG00000060688
AA Change: K259E

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 2.6e-48 PFAM
Pfam:7tm_1 39 288 2.7e-22 PFAM
Meta Mutation Damage Score 0.1244 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,686,066 S2T probably benign Het
Abca3 C T 17: 24,408,122 R1266C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 V670D probably damaging Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
AY074887 T C 9: 54,950,818 probably benign Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Catspere1 A T 1: 177,879,782 noncoding transcript Het
Cnmd T C 14: 79,656,686 Q87R probably benign Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Cyp2d26 T C 15: 82,790,989 Q388R probably benign Het
Ddb1 A T 19: 10,622,364 T646S probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Dzank1 T C 2: 144,483,412 H545R probably damaging Het
Ehhadh T A 16: 21,766,511 M207L probably benign Het
Elmo2 T A 2: 165,291,707 probably benign Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Igsf21 T C 4: 140,028,067 T426A possibly damaging Het
Kcnf1 T C 12: 17,174,741 E493G probably benign Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Map3k20 A T 2: 72,438,214 T522S probably benign Het
Mpp5 T A 12: 78,820,815 M324K possibly damaging Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Msln T C 17: 25,752,983 M87V probably benign Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 probably benign Het
Pprc1 G T 19: 46,064,758 probably benign Het
Ptprm T A 17: 66,957,097 K385I probably benign Het
Rfxap T A 3: 54,804,517 N215I probably damaging Het
Slc16a7 A T 10: 125,233,464 Y114* probably null Het
Smarcb1 G T 10: 75,911,794 probably benign Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Uba7 G A 9: 107,980,047 V703I probably benign Het
Upb1 T C 10: 75,412,804 S53P possibly damaging Het
Zfp672 A G 11: 58,316,851 S215P possibly damaging Het
Zfp978 T A 4: 147,390,980 L328H probably damaging Het
Other mutations in Olfr292
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Olfr292 APN 7 86695293 missense probably benign 0.10
IGL01751:Olfr292 APN 7 86694789 missense probably benign
IGL02417:Olfr292 APN 7 86694819 missense probably damaging 1.00
IGL02534:Olfr292 APN 7 86694731 missense probably benign 0.17
IGL02830:Olfr292 APN 7 86695174 missense probably damaging 1.00
R0281:Olfr292 UTSW 7 86694860 missense probably benign 0.00
R0423:Olfr292 UTSW 7 86695226 missense possibly damaging 0.95
R0555:Olfr292 UTSW 7 86695308 missense probably damaging 1.00
R0609:Olfr292 UTSW 7 86694876 missense possibly damaging 0.85
R0662:Olfr292 UTSW 7 86694630 missense possibly damaging 0.88
R1710:Olfr292 UTSW 7 86695110 missense probably benign 0.00
R2144:Olfr292 UTSW 7 86695280 missense probably damaging 0.98
R4400:Olfr292 UTSW 7 86694590 missense probably benign 0.10
R4615:Olfr292 UTSW 7 86694728 missense probably damaging 1.00
R4762:Olfr292 UTSW 7 86695121 missense probably benign 0.01
R4785:Olfr292 UTSW 7 86694528 missense probably damaging 1.00
R4823:Olfr292 UTSW 7 86694588 missense probably damaging 0.99
R4908:Olfr292 UTSW 7 86695187 missense probably benign 0.00
R4983:Olfr292 UTSW 7 86694479 missense probably benign 0.01
R5010:Olfr292 UTSW 7 86694585 missense possibly damaging 0.95
R5024:Olfr292 UTSW 7 86694881 missense probably benign 0.05
R5627:Olfr292 UTSW 7 86695139 missense possibly damaging 0.93
R6327:Olfr292 UTSW 7 86694552 missense probably benign 0.09
R6375:Olfr292 UTSW 7 86695059 missense probably benign 0.01
R6775:Olfr292 UTSW 7 86695149 missense probably benign 0.02
R7257:Olfr292 UTSW 7 86694804 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCTGCCATTGGTCTCAGTG -3'
(R):5'- CTGTCTATATGTGAGGCCATGG -3'

Sequencing Primer
(F):5'- CAGTGGTAGCTGCTTTACATTC -3'
(R):5'- AGTCTAAAAATGTTTTGATGTGTGTG -3'
Posted On2016-06-21