Incidental Mutation 'R5157:AY074887'
ID396782
Institutional Source Beutler Lab
Gene Symbol AY074887
Ensembl Gene ENSMUSG00000044820
Gene NamecDNA sequence AY074887
SynonymsMcpr1
MMRRC Submission 042739-MU
Accession Numbers

Genbank: NM_145229; MGI: 3575512

Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5157 (G1)
Quality Score163
Status Validated
Chromosome9
Chromosomal Location54950230-54950998 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) T to C at 54950818 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034848] [ENSMUST00000039742] [ENSMUST00000054018] [ENSMUST00000171900] [ENSMUST00000172407]
Predicted Effect probably benign
Transcript: ENSMUST00000034848
SMART Domains Protein: ENSMUSP00000034848
Gene: ENSMUSG00000032301

DomainStartEndE-ValueType
Proteasome_A_N 5 27 1.6e-9 SMART
Pfam:Proteasome 28 216 1.5e-57 PFAM
low complexity region 238 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039742
SMART Domains Protein: ENSMUSP00000039980
Gene: ENSMUSG00000035878

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:APH 36 300 2.2e-37 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000054018
AA Change: I8V
SMART Domains Protein: ENSMUSP00000049861
Gene: ENSMUSG00000044820
AA Change: I8V

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
transmembrane domain 105 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171578
Predicted Effect probably benign
Transcript: ENSMUST00000171900
SMART Domains Protein: ENSMUSP00000132368
Gene: ENSMUSG00000032301

DomainStartEndE-ValueType
Proteasome_A_N 5 27 1.6e-9 SMART
Pfam:Proteasome 28 139 1.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172407
SMART Domains Protein: ENSMUSP00000126844
Gene: ENSMUSG00000032301

DomainStartEndE-ValueType
Proteasome_A_N 5 27 1.6e-9 SMART
Pfam:Proteasome 28 210 3.2e-56 PFAM
Meta Mutation Damage Score 0.0508 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,686,066 S2T probably benign Het
Abca3 C T 17: 24,408,122 R1266C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 V670D probably damaging Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Catspere1 A T 1: 177,879,782 noncoding transcript Het
Cnmd T C 14: 79,656,686 Q87R probably benign Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Cyp2d26 T C 15: 82,790,989 Q388R probably benign Het
Ddb1 A T 19: 10,622,364 T646S probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Dzank1 T C 2: 144,483,412 H545R probably damaging Het
Ehhadh T A 16: 21,766,511 M207L probably benign Het
Elmo2 T A 2: 165,291,707 probably benign Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Igsf21 T C 4: 140,028,067 T426A possibly damaging Het
Kcnf1 T C 12: 17,174,741 E493G probably benign Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Map3k20 A T 2: 72,438,214 T522S probably benign Het
Mpp5 T A 12: 78,820,815 M324K possibly damaging Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Msln T C 17: 25,752,983 M87V probably benign Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr292 A G 7: 86,695,232 K259E probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 probably benign Het
Pprc1 G T 19: 46,064,758 probably benign Het
Ptprm T A 17: 66,957,097 K385I probably benign Het
Rfxap T A 3: 54,804,517 N215I probably damaging Het
Slc16a7 A T 10: 125,233,464 Y114* probably null Het
Smarcb1 G T 10: 75,911,794 probably benign Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Uba7 G A 9: 107,980,047 V703I probably benign Het
Upb1 T C 10: 75,412,804 S53P possibly damaging Het
Zfp672 A G 11: 58,316,851 S215P possibly damaging Het
Zfp978 T A 4: 147,390,980 L328H probably damaging Het
Other mutations in AY074887
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:AY074887 APN 9 54950679 unclassified probably benign
R7023:AY074887 UTSW 9 54950865 utr 5 prime probably benign
Predicted Primers PCR Primer
(F):5'- TCTCCACGGTATAGACGCTTC -3'
(R):5'- TGCAAAGTCATCGTGCCCAC -3'

Sequencing Primer
(F):5'- ACGGTATAGACGCTTCCCTCC -3'
(R):5'- CCCACGGCTCCTCGGTG -3'
Posted On2016-06-21