Incidental Mutation 'R5157:Uba7'
ID396783
Institutional Source Beutler Lab
Gene Symbol Uba7
Ensembl Gene ENSMUSG00000032596
Gene Nameubiquitin-like modifier activating enzyme 7
Synonyms1300004C08Rik, Ube1l
MMRRC Submission 042739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R5157 (G1)
Quality Score190
Status Validated
Chromosome9
Chromosomal Location107975505-107984060 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 107980047 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 703 (V703I)
Ref Sequence ENSEMBL: ENSMUSP00000035216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035216] [ENSMUST00000048568] [ENSMUST00000175914] [ENSMUST00000177368] [ENSMUST00000177392]
Predicted Effect probably benign
Transcript: ENSMUST00000035216
AA Change: V703I

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000035216
Gene: ENSMUSG00000032596
AA Change: V703I

DomainStartEndE-ValueType
Pfam:ThiF 6 401 1.2e-33 PFAM
Pfam:E1_FCCH 178 249 1.1e-26 PFAM
Pfam:E1_4HB 250 318 2.5e-22 PFAM
internal_repeat_1 402 510 8.05e-5 PROSPERO
Pfam:UBA_e1_thiolCys 592 808 1.3e-50 PFAM
UBA_e1_C 846 973 4.63e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000048568
SMART Domains Protein: ENSMUSP00000040433
Gene: ENSMUSG00000042106

DomainStartEndE-ValueType
low complexity region 52 73 N/A INTRINSIC
Pfam:FAM212 146 201 1.7e-30 PFAM
low complexity region 228 237 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000075082
Predicted Effect probably benign
Transcript: ENSMUST00000175914
SMART Domains Protein: ENSMUSP00000134980
Gene: ENSMUSG00000042106

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176858
Predicted Effect probably benign
Transcript: ENSMUST00000177039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177096
Predicted Effect probably benign
Transcript: ENSMUST00000177368
SMART Domains Protein: ENSMUSP00000135553
Gene: ENSMUSG00000079323

DomainStartEndE-ValueType
Blast:UBA_e1_C 1 39 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177392
SMART Domains Protein: ENSMUSP00000134910
Gene: ENSMUSG00000032596

DomainStartEndE-ValueType
Pfam:ThiF 22 153 1.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177494
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E1 ubiquitin-activating enzyme family. The encoded enzyme is a retinoid target that triggers promyelocytic leukemia (PML)/retinoic acid receptor alpha (RARalpha) degradation and apoptosis in acute promyelocytic leukemia, where it is involved in the conjugation of the ubiquitin-like interferon-stimulated gene 15 protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice lacking ISG15 conjugation but not free ISG15 are healthy and fertile and exhibit normal antiviral responses against vesicular stomatitis virus and lymphocytic choriomeningitis virus infection. Bone-derived macrophages from mutant mice display normal responses to IFN treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,686,066 S2T probably benign Het
Abca3 C T 17: 24,408,122 R1266C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 V670D probably damaging Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
AY074887 T C 9: 54,950,818 probably benign Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Catspere1 A T 1: 177,879,782 noncoding transcript Het
Cnmd T C 14: 79,656,686 Q87R probably benign Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Cyp2d26 T C 15: 82,790,989 Q388R probably benign Het
Ddb1 A T 19: 10,622,364 T646S probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Dzank1 T C 2: 144,483,412 H545R probably damaging Het
Ehhadh T A 16: 21,766,511 M207L probably benign Het
Elmo2 T A 2: 165,291,707 probably benign Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Igsf21 T C 4: 140,028,067 T426A possibly damaging Het
Kcnf1 T C 12: 17,174,741 E493G probably benign Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Map3k20 A T 2: 72,438,214 T522S probably benign Het
Mpp5 T A 12: 78,820,815 M324K possibly damaging Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Msln T C 17: 25,752,983 M87V probably benign Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr292 A G 7: 86,695,232 K259E probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 probably benign Het
Pprc1 G T 19: 46,064,758 probably benign Het
Ptprm T A 17: 66,957,097 K385I probably benign Het
Rfxap T A 3: 54,804,517 N215I probably damaging Het
Slc16a7 A T 10: 125,233,464 Y114* probably null Het
Smarcb1 G T 10: 75,911,794 probably benign Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Upb1 T C 10: 75,412,804 S53P possibly damaging Het
Zfp672 A G 11: 58,316,851 S215P possibly damaging Het
Zfp978 T A 4: 147,390,980 L328H probably damaging Het
Other mutations in Uba7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Uba7 APN 9 107979111 missense probably benign 0.31
IGL01696:Uba7 APN 9 107977348 missense probably damaging 1.00
IGL02137:Uba7 APN 9 107979753 splice site probably benign
IGL02272:Uba7 APN 9 107976153 missense probably benign 0.01
IGL02287:Uba7 APN 9 107978227 missense probably benign 0.10
IGL02430:Uba7 APN 9 107979468 splice site probably benign
IGL02552:Uba7 APN 9 107981390 missense probably benign 0.00
IGL02820:Uba7 APN 9 107981516 missense probably benign 0.01
IGL03234:Uba7 APN 9 107976400 missense probably damaging 0.97
R0013:Uba7 UTSW 9 107978249 missense probably damaging 1.00
R0013:Uba7 UTSW 9 107978249 missense probably damaging 1.00
R0717:Uba7 UTSW 9 107977217 missense probably benign 0.44
R2108:Uba7 UTSW 9 107979288 missense probably benign
R2253:Uba7 UTSW 9 107976364 missense probably benign 0.26
R4239:Uba7 UTSW 9 107976802 critical splice donor site probably null
R4528:Uba7 UTSW 9 107983903 missense possibly damaging 0.79
R4735:Uba7 UTSW 9 107976916 missense possibly damaging 0.94
R4736:Uba7 UTSW 9 107980165 missense probably benign 0.00
R4751:Uba7 UTSW 9 107979805 missense possibly damaging 0.66
R4937:Uba7 UTSW 9 107978991 missense possibly damaging 0.95
R4999:Uba7 UTSW 9 107979839 critical splice donor site probably null
R5020:Uba7 UTSW 9 107978914 missense probably benign
R5214:Uba7 UTSW 9 107977514 intron probably benign
R5339:Uba7 UTSW 9 107978866 missense probably damaging 1.00
R5990:Uba7 UTSW 9 107981234 missense probably damaging 0.96
R6092:Uba7 UTSW 9 107983160 missense possibly damaging 0.96
R6110:Uba7 UTSW 9 107978939 missense probably benign 0.25
R6363:Uba7 UTSW 9 107980183 critical splice donor site probably null
R6495:Uba7 UTSW 9 107977014 nonsense probably null
R6644:Uba7 UTSW 9 107981472 missense possibly damaging 0.55
R7032:Uba7 UTSW 9 107976172 missense possibly damaging 0.83
R7095:Uba7 UTSW 9 107983339 missense probably benign 0.01
X0024:Uba7 UTSW 9 107975945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAGTAGTGTCAGCAGACC -3'
(R):5'- ACAGGCTGAAGACCCATGTG -3'

Sequencing Primer
(F):5'- TCAGCAGACCTGAGTATCCTGAG -3'
(R):5'- CCATGTGGGGAAGGGGC -3'
Posted On2016-06-21