Incidental Mutation 'R5157:Slc16a7'
ID396788
Institutional Source Beutler Lab
Gene Symbol Slc16a7
Ensembl Gene ENSMUSG00000020102
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 7
Synonyms4921534N07Rik, MCT2
MMRRC Submission 042739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5157 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location125219270-125389465 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 125233464 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 114 (Y114*)
Ref Sequence ENSEMBL: ENSMUSP00000147968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063318] [ENSMUST00000105257] [ENSMUST00000210780] [ENSMUST00000211781]
Predicted Effect probably null
Transcript: ENSMUST00000063318
AA Change: Y114*
SMART Domains Protein: ENSMUSP00000065433
Gene: ENSMUSG00000020102
AA Change: Y114*

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:MFS_1 22 389 2e-37 PFAM
transmembrane domain 404 426 N/A INTRINSIC
coiled coil region 436 463 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105257
AA Change: Y114*
SMART Domains Protein: ENSMUSP00000100892
Gene: ENSMUSG00000020102
AA Change: Y114*

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:MFS_1 22 389 6e-37 PFAM
transmembrane domain 404 426 N/A INTRINSIC
coiled coil region 436 463 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000210780
AA Change: Y114*
Predicted Effect probably null
Transcript: ENSMUST00000211781
AA Change: Y114*
Meta Mutation Damage Score 0.624 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the monocarboxylate transporter family. Members in this family transport metabolites, such as lactate, pyruvate, and ketone bodies. The protein encoded by this gene catalyzes the proton-linked transport of monocarboxylates and has the highest affinity for pyruvate. This protein has been reported to be more highly expressed in prostate and colorectal cancer specimens when compared to control specimens. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,686,066 S2T probably benign Het
Abca3 C T 17: 24,408,122 R1266C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 V670D probably damaging Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
AY074887 T C 9: 54,950,818 probably benign Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Catspere1 A T 1: 177,879,782 noncoding transcript Het
Cnmd T C 14: 79,656,686 Q87R probably benign Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Cyp2d26 T C 15: 82,790,989 Q388R probably benign Het
Ddb1 A T 19: 10,622,364 T646S probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Dzank1 T C 2: 144,483,412 H545R probably damaging Het
Ehhadh T A 16: 21,766,511 M207L probably benign Het
Elmo2 T A 2: 165,291,707 probably benign Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Igsf21 T C 4: 140,028,067 T426A possibly damaging Het
Kcnf1 T C 12: 17,174,741 E493G probably benign Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Map3k20 A T 2: 72,438,214 T522S probably benign Het
Mpp5 T A 12: 78,820,815 M324K possibly damaging Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Msln T C 17: 25,752,983 M87V probably benign Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr292 A G 7: 86,695,232 K259E probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 probably benign Het
Pprc1 G T 19: 46,064,758 probably benign Het
Ptprm T A 17: 66,957,097 K385I probably benign Het
Rfxap T A 3: 54,804,517 N215I probably damaging Het
Smarcb1 G T 10: 75,911,794 probably benign Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Uba7 G A 9: 107,980,047 V703I probably benign Het
Upb1 T C 10: 75,412,804 S53P possibly damaging Het
Zfp672 A G 11: 58,316,851 S215P possibly damaging Het
Zfp978 T A 4: 147,390,980 L328H probably damaging Het
Other mutations in Slc16a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Slc16a7 APN 10 125230934 missense probably benign 0.16
IGL02228:Slc16a7 APN 10 125230798 missense probably damaging 1.00
IGL02500:Slc16a7 APN 10 125230933 missense probably damaging 1.00
IGL03277:Slc16a7 APN 10 125230691 missense probably benign 0.00
R0044:Slc16a7 UTSW 10 125228082 missense probably benign 0.01
R0076:Slc16a7 UTSW 10 125228070 missense probably benign 0.34
R0285:Slc16a7 UTSW 10 125294631 missense probably benign 0.22
R0546:Slc16a7 UTSW 10 125230873 missense probably benign 0.02
R0898:Slc16a7 UTSW 10 125233501 missense possibly damaging 0.46
R1123:Slc16a7 UTSW 10 125231147 missense probably benign 0.00
R1173:Slc16a7 UTSW 10 125231372 missense possibly damaging 0.82
R1459:Slc16a7 UTSW 10 125230620 nonsense probably null
R1554:Slc16a7 UTSW 10 125230922 missense possibly damaging 0.70
R1838:Slc16a7 UTSW 10 125231198 missense probably damaging 1.00
R3545:Slc16a7 UTSW 10 125294700 nonsense probably null
R3546:Slc16a7 UTSW 10 125294700 nonsense probably null
R3547:Slc16a7 UTSW 10 125294700 nonsense probably null
R3934:Slc16a7 UTSW 10 125230843 missense probably damaging 1.00
R3935:Slc16a7 UTSW 10 125230843 missense probably damaging 1.00
R4499:Slc16a7 UTSW 10 125228187 missense probably damaging 1.00
R4512:Slc16a7 UTSW 10 125233439 splice site probably null
R4513:Slc16a7 UTSW 10 125233439 splice site probably null
R4514:Slc16a7 UTSW 10 125233439 splice site probably null
R5247:Slc16a7 UTSW 10 125231314 missense probably damaging 1.00
R5385:Slc16a7 UTSW 10 125294604 missense possibly damaging 0.85
R6198:Slc16a7 UTSW 10 125228215 missense probably benign
R6263:Slc16a7 UTSW 10 125294639 missense probably benign 0.16
R6430:Slc16a7 UTSW 10 125231018 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACCTGCAGGATGACACATGC -3'
(R):5'- GTGCACTGATCTCTTTTGATCACTG -3'

Sequencing Primer
(F):5'- TGACACATGCAAAACTGTATGG -3'
(R):5'- CCTCTCAGAACAAAGAAGTATTAAGG -3'
Posted On2016-06-21