Incidental Mutation 'R5157:0610009B22Rik'
List |< first << previous [record 7 of 386652] next >> last >|
ID396789
Institutional Source Beutler Lab
Gene Symbol 0610009B22Rik
Ensembl Gene ENSMUSG00000007777
Gene NameRIKEN cDNA 0610009B22 gene
Synonyms
MMRRC Submission 042739-MU
Accession Numbers
Stock #R5157 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location51685386-51688874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51686066 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 2 (S2T)
Ref Sequence ENSEMBL: ENSMUSP00000007921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007921] [ENSMUST00000109098]
Predicted Effect probably benign
Transcript: ENSMUST00000007921
AA Change: S2T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000007921
Gene: ENSMUSG00000007777
AA Change: S2T

DomainStartEndE-ValueType
Pfam:Sedlin_N 9 136 7.3e-52 PFAM
Pfam:Sybindin 46 137 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109098
AA Change: S2T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104726
Gene: ENSMUSG00000007777
AA Change: S2T

DomainStartEndE-ValueType
Pfam:Sedlin_N 9 136 1e-50 PFAM
Pfam:Sybindin 46 137 1.4e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 C T 17: 24,408,122 R1521C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 C1871* probably null Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Cyp2d26 T C 15: 82,790,989 Q388R probably benign Het
Ddb1 A T 19: 10,622,364 T646S probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Dzank1 T C 2: 144,483,412 H545R probably damaging Het
Ehhadh T A 16: 21,766,511 M207L probably benign Het
Elmo2 T A 2: 165,291,707 D787V unknown Het
Gm13145 T A 4: 147,390,980 L328H probably damaging Het
Gm7068 A T 1: 177,879,782 N538I noncoding transcript Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Herpud1 G A 8: 94,393,847 R106Q noncoding transcript Het
Igsf21 T C 4: 140,028,067 T426A possibly damaging Het
Kbtbd12 G A 6: 88,618,133 S293F noncoding transcript Het
Kcnf1 T C 12: 17,174,741 E493G probably benign Het
Lect1 T C 14: 79,656,686 Q87R probably benign Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Mcmbp G A 7: 128,712,735 Q164* probably null Het
Mpp5 T A 12: 78,820,815 M324K possibly damaging Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Msln T C 17: 25,752,983 M87V probably benign Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr292 A G 7: 86,695,232 K259E probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 M77K noncoding transcript Het
Pprc1 G T 19: 46,064,758 C908F unknown Het
Psma4 T C 9: 54,950,818 I8V unknown Het
Ptprm T A 17: 66,957,097 K385I probably benign Het
Rfxap T A 3: 54,804,517 N215I probably damaging Het
Rsad1 A G 11: 94,542,601 V467A noncoding transcript Het
Satb1 A T 17: 51,742,074 C65S noncoding transcript Het
Slc16a7 A T 10: 125,233,464 Y114* probably null Het
Smarcb1 G T 10: 75,911,794 T45K unknown Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T54K probably damaging Het
Uba7 G A 9: 107,980,047 V703I probably benign Het
Upb1 T C 10: 75,412,804 S48P probably benign Het
Zak A T 2: 72,438,214 T522S probably benign Het
Zfp672 A G 11: 58,316,851 S215P possibly damaging Het
Other mutations in 0610009B22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:0610009B22Rik APN 11 51685843 missense probably damaging 0.99
R1657:0610009B22Rik UTSW 11 51685678 missense probably benign 0.00
R5387:0610009B22Rik UTSW 11 51685974 missense probably benign
R5541:0610009B22Rik UTSW 11 51685969 missense probably benign 0.02
R5649:0610009B22Rik UTSW 11 51685972 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTGGAGAGCCACATGTTTTC -3'
(R):5'- CTATCATTTTAAATCAGTGGGGAGG -3'

Sequencing Primer
(F):5'- GAGAGCCACATGTTTTCGTCGAC -3'
(R):5'- TAATAAATATAGCTAGGTGTGGTGGC -3'
Posted OnJun 21, 2016