Incidental Mutation 'R5157:Mpp5'
ID396795
Institutional Source Beutler Lab
Gene Symbol Mpp5
Ensembl Gene ENSMUSG00000021112
Gene Namemembrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)
SynonymsPals1, 3830420B02Rik
MMRRC Submission 042739-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.698) question?
Stock #R5157 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location78748907-78840714 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78820815 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 324 (M324K)
Ref Sequence ENSEMBL: ENSMUSP00000080683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082024] [ENSMUST00000219197]
PDB Structure
Solution structure of the PDZ domain of Pals1 protein [SOLUTION NMR]
2.1 Angstrom crystal structure of the PALS-1-L27N and PATJ L27 heterodimer complex [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082024
AA Change: M324K

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080683
Gene: ENSMUSG00000021112
AA Change: M324K

DomainStartEndE-ValueType
coiled coil region 54 76 N/A INTRINSIC
L27 123 180 2.04e-10 SMART
L27 186 238 7.39e-8 SMART
PDZ 265 336 5.99e-13 SMART
SH3 348 416 1.2e-10 SMART
low complexity region 439 454 N/A INTRINSIC
GuKc 478 663 1.72e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219197
Meta Mutation Damage Score 0.39 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the p55-like subfamily of the membrane-associated guanylate kinase (MAGUK) gene superfamily. The encoded protein participates in the polarization of differentiating cells, has been shown to regulate myelinating Schwann cells (PMID: 20237282), and is one of the components of the Crumbs complex in the retina. Mice which express lower levels of the orthologous protein have retinal degeneration and impaired vision (PMID: 22114289). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a floxed allele activated in cortical neuron exhibit loss of cortex neurons due to premature differentiation and increased apoptosis. These mice also exhibit behavioral defects but are otherwise viable and fertile. Heterozygous mice exhibit an intermediate phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,686,066 S2T probably benign Het
Abca3 C T 17: 24,408,122 R1266C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 V670D probably damaging Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
AY074887 T C 9: 54,950,818 probably benign Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Catspere1 A T 1: 177,879,782 noncoding transcript Het
Cnmd T C 14: 79,656,686 Q87R probably benign Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Cyp2d26 T C 15: 82,790,989 Q388R probably benign Het
Ddb1 A T 19: 10,622,364 T646S probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Dzank1 T C 2: 144,483,412 H545R probably damaging Het
Ehhadh T A 16: 21,766,511 M207L probably benign Het
Elmo2 T A 2: 165,291,707 probably benign Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Igsf21 T C 4: 140,028,067 T426A possibly damaging Het
Kcnf1 T C 12: 17,174,741 E493G probably benign Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Map3k20 A T 2: 72,438,214 T522S probably benign Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Msln T C 17: 25,752,983 M87V probably benign Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr292 A G 7: 86,695,232 K259E probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 probably benign Het
Pprc1 G T 19: 46,064,758 probably benign Het
Ptprm T A 17: 66,957,097 K385I probably benign Het
Rfxap T A 3: 54,804,517 N215I probably damaging Het
Slc16a7 A T 10: 125,233,464 Y114* probably null Het
Smarcb1 G T 10: 75,911,794 probably benign Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Uba7 G A 9: 107,980,047 V703I probably benign Het
Upb1 T C 10: 75,412,804 S53P possibly damaging Het
Zfp672 A G 11: 58,316,851 S215P possibly damaging Het
Zfp978 T A 4: 147,390,980 L328H probably damaging Het
Other mutations in Mpp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Mpp5 APN 12 78829799 missense possibly damaging 0.89
IGL00863:Mpp5 APN 12 78809821 missense probably damaging 1.00
IGL01860:Mpp5 APN 12 78830907 missense possibly damaging 0.79
R1584:Mpp5 UTSW 12 78829727 missense probably benign 0.34
R1632:Mpp5 UTSW 12 78797038 nonsense probably null
R2117:Mpp5 UTSW 12 78809922 missense possibly damaging 0.81
R2186:Mpp5 UTSW 12 78819371 splice site probably benign
R2211:Mpp5 UTSW 12 78797248 missense possibly damaging 0.78
R4044:Mpp5 UTSW 12 78824839 missense probably benign 0.06
R4224:Mpp5 UTSW 12 78829718 missense probably damaging 1.00
R4535:Mpp5 UTSW 12 78824837 missense possibly damaging 0.90
R6144:Mpp5 UTSW 12 78824789 missense possibly damaging 0.75
R6180:Mpp5 UTSW 12 78817310 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ACTGGGCAGGAATTATGAATCTAGC -3'
(R):5'- CAACACTGTTAGTCTGAAGTTGAAC -3'

Sequencing Primer
(F):5'- GCAGGAATTATGAATCTAGCTGCAC -3'
(R):5'- ACGTGATTTCTGTTTTTACTTGAAC -3'
Posted On2016-06-21