Incidental Mutation 'R5157:Ehhadh'
ID396800
Institutional Source Beutler Lab
Gene Symbol Ehhadh
Ensembl Gene ENSMUSG00000022853
Gene Nameenoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase
SynonymsMFP, L-PBE, MFP1, L-bifunctional enzyme, 1300002P22Rik, HD
MMRRC Submission 042739-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5157 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location21761287-21787807 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21766511 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 207 (M207L)
Ref Sequence ENSEMBL: ENSMUSP00000023559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023559]
Predicted Effect probably benign
Transcript: ENSMUST00000023559
AA Change: M207L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000023559
Gene: ENSMUSG00000022853
AA Change: M207L

DomainStartEndE-ValueType
Pfam:ECH_1 6 203 2.4e-41 PFAM
Pfam:ECH_2 11 254 3.2e-26 PFAM
Pfam:3HCDH_N 297 471 1e-55 PFAM
Pfam:3HCDH 473 577 2.7e-29 PFAM
Pfam:3HCDH 614 710 5.3e-10 PFAM
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme and is one of the four enzymes of the peroxisomal beta-oxidation pathway. The N-terminal region of the encoded protein contains enoyl-CoA hydratase activity while the C-terminal region contains 3-hydroxyacyl-CoA dehydrogenase activity. Defects in this gene are a cause of peroxisomal disorders such as Zellweger syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruption of this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,686,066 S2T probably benign Het
Abca3 C T 17: 24,408,122 R1266C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 V670D probably damaging Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
AY074887 T C 9: 54,950,818 probably benign Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Catspere1 A T 1: 177,879,782 noncoding transcript Het
Cnmd T C 14: 79,656,686 Q87R probably benign Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Cyp2d26 T C 15: 82,790,989 Q388R probably benign Het
Ddb1 A T 19: 10,622,364 T646S probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Dzank1 T C 2: 144,483,412 H545R probably damaging Het
Elmo2 T A 2: 165,291,707 probably benign Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Igsf21 T C 4: 140,028,067 T426A possibly damaging Het
Kcnf1 T C 12: 17,174,741 E493G probably benign Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Map3k20 A T 2: 72,438,214 T522S probably benign Het
Mpp5 T A 12: 78,820,815 M324K possibly damaging Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Msln T C 17: 25,752,983 M87V probably benign Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr292 A G 7: 86,695,232 K259E probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 probably benign Het
Pprc1 G T 19: 46,064,758 probably benign Het
Ptprm T A 17: 66,957,097 K385I probably benign Het
Rfxap T A 3: 54,804,517 N215I probably damaging Het
Slc16a7 A T 10: 125,233,464 Y114* probably null Het
Smarcb1 G T 10: 75,911,794 probably benign Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Uba7 G A 9: 107,980,047 V703I probably benign Het
Upb1 T C 10: 75,412,804 S53P possibly damaging Het
Zfp672 A G 11: 58,316,851 S215P possibly damaging Het
Zfp978 T A 4: 147,390,980 L328H probably damaging Het
Other mutations in Ehhadh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Ehhadh APN 16 21762629 missense possibly damaging 0.46
IGL02351:Ehhadh APN 16 21762870 missense probably damaging 1.00
IGL02358:Ehhadh APN 16 21762870 missense probably damaging 1.00
IGL02946:Ehhadh APN 16 21762922 missense probably damaging 1.00
IGL03028:Ehhadh APN 16 21762394 missense probably damaging 1.00
IGL03274:Ehhadh APN 16 21763340 splice site probably benign
IGL03097:Ehhadh UTSW 16 21762770 missense probably benign
R0201:Ehhadh UTSW 16 21773493 critical splice donor site probably null
R0846:Ehhadh UTSW 16 21773497 nonsense probably null
R1194:Ehhadh UTSW 16 21762091 missense probably benign 0.10
R1601:Ehhadh UTSW 16 21766408 missense probably benign
R1739:Ehhadh UTSW 16 21762253 missense probably benign
R1829:Ehhadh UTSW 16 21762178 missense probably damaging 0.99
R4073:Ehhadh UTSW 16 21766507 missense probably benign 0.00
R4120:Ehhadh UTSW 16 21763184 missense probably benign
R4239:Ehhadh UTSW 16 21762688 missense probably damaging 1.00
R4303:Ehhadh UTSW 16 21762852 missense probably damaging 1.00
R4727:Ehhadh UTSW 16 21762431 missense probably benign 0.11
R4838:Ehhadh UTSW 16 21763202 missense possibly damaging 0.45
R5284:Ehhadh UTSW 16 21763344 splice site probably null
R5307:Ehhadh UTSW 16 21762692 missense probably benign 0.09
R5346:Ehhadh UTSW 16 21762790 missense probably damaging 1.00
R5872:Ehhadh UTSW 16 21766555 missense probably benign 0.01
R6762:Ehhadh UTSW 16 21762459 missense probably benign 0.01
R6960:Ehhadh UTSW 16 21762278 missense probably benign
R7153:Ehhadh UTSW 16 21766321 missense probably damaging 1.00
X0018:Ehhadh UTSW 16 21762448 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GGGAGTTGACCACTTATTTGCAG -3'
(R):5'- CGGTCTGAAGTTACTAAGATTACAG -3'

Sequencing Primer
(F):5'- AAAGGCGTACTGCAGGGCTC -3'
(R):5'- TTACAGACTTTGGATATCGTGTTTC -3'
Posted On2016-06-21