Incidental Mutation 'R5157:Msln'
ID396802
Institutional Source Beutler Lab
Gene Symbol Msln
Ensembl Gene ENSMUSG00000063011
Gene Namemesothelin
SynonymsMPF, megakaryocyte potentiating factor
MMRRC Submission 042739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R5157 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25748614-25754327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25752983 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 87 (M87V)
Ref Sequence ENSEMBL: ENSMUSP00000075279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098] [ENSMUST00000075884]
Predicted Effect probably benign
Transcript: ENSMUST00000047098
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075884
AA Change: M87V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000075279
Gene: ENSMUSG00000063011
AA Change: M87V

DomainStartEndE-ValueType
Pfam:Mesothelin 1 624 N/A PFAM
Meta Mutation Damage Score 0.1268 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a preproprotein that is proteolytically processed to generate two protein products, megakaryocyte potentiating factor and mesothelin. Megakaryocyte potentiating factor functions as a cytokine that can stimulate colony formation of bone marrow megakaryocytes. Mesothelin is a glycosylphosphatidylinositol-anchored cell-surface protein that may function as a cell adhesion protein. This protein is overexpressed in epithelial mesotheliomas, ovarian cancers and in specific squamous cell carcinomas. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for disruptions in this allele display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,686,066 S2T probably benign Het
Abca3 C T 17: 24,408,122 R1266C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 V670D probably damaging Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
AY074887 T C 9: 54,950,818 probably benign Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Catspere1 A T 1: 177,879,782 noncoding transcript Het
Cnmd T C 14: 79,656,686 Q87R probably benign Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Cyp2d26 T C 15: 82,790,989 Q388R probably benign Het
Ddb1 A T 19: 10,622,364 T646S probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Dzank1 T C 2: 144,483,412 H545R probably damaging Het
Ehhadh T A 16: 21,766,511 M207L probably benign Het
Elmo2 T A 2: 165,291,707 probably benign Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Igsf21 T C 4: 140,028,067 T426A possibly damaging Het
Kcnf1 T C 12: 17,174,741 E493G probably benign Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Map3k20 A T 2: 72,438,214 T522S probably benign Het
Mpp5 T A 12: 78,820,815 M324K possibly damaging Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr292 A G 7: 86,695,232 K259E probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 probably benign Het
Pprc1 G T 19: 46,064,758 probably benign Het
Ptprm T A 17: 66,957,097 K385I probably benign Het
Rfxap T A 3: 54,804,517 N215I probably damaging Het
Slc16a7 A T 10: 125,233,464 Y114* probably null Het
Smarcb1 G T 10: 75,911,794 probably benign Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Uba7 G A 9: 107,980,047 V703I probably benign Het
Upb1 T C 10: 75,412,804 S53P possibly damaging Het
Zfp672 A G 11: 58,316,851 S215P possibly damaging Het
Zfp978 T A 4: 147,390,980 L328H probably damaging Het
Other mutations in Msln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Msln APN 17 25750030 critical splice donor site probably null
IGL02986:Msln APN 17 25752933 splice site probably benign
R0349:Msln UTSW 17 25750276 missense possibly damaging 0.69
R0562:Msln UTSW 17 25753006 missense probably benign 0.16
R0845:Msln UTSW 17 25750796 missense probably damaging 1.00
R1256:Msln UTSW 17 25754183 missense probably damaging 1.00
R1305:Msln UTSW 17 25753027 missense probably benign 0.00
R1651:Msln UTSW 17 25753408 missense probably benign 0.00
R1930:Msln UTSW 17 25751922 missense probably damaging 0.99
R1996:Msln UTSW 17 25754219 start codon destroyed possibly damaging 0.94
R4532:Msln UTSW 17 25750724 missense probably damaging 0.98
R5004:Msln UTSW 17 25754219 start codon destroyed possibly damaging 0.94
R5159:Msln UTSW 17 25751589 missense probably benign 0.01
R5510:Msln UTSW 17 25749873 missense probably benign 0.15
R6385:Msln UTSW 17 25751141 missense probably benign 0.19
R6650:Msln UTSW 17 25750170 missense probably benign 0.00
R6682:Msln UTSW 17 25753019 missense probably damaging 0.99
R7091:Msln UTSW 17 25750080 missense probably damaging 1.00
X0002:Msln UTSW 17 25752310 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TTCAGTTAGGCAGCAAGAGG -3'
(R):5'- TGTCACTTGTCCCAAAGAGG -3'

Sequencing Primer
(F):5'- TTAGGCAGCAAGAGGGGCTC -3'
(R):5'- TCATGAGAAGCCCAGGGTTATG -3'
Posted On2016-06-21