Incidental Mutation 'R5157:Ptprm'
ID396804
Institutional Source Beutler Lab
Gene Symbol Ptprm
Ensembl Gene ENSMUSG00000033278
Gene Nameprotein tyrosine phosphatase, receptor type, M
SynonymsRPTPmu
MMRRC Submission 042739-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5157 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location66666947-67354457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66957097 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Isoleucine at position 385 (K385I)
Ref Sequence ENSEMBL: ENSMUSP00000153463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037974] [ENSMUST00000223982] [ENSMUST00000224091] [ENSMUST00000224862]
Predicted Effect probably benign
Transcript: ENSMUST00000037974
AA Change: K385I

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000045603
Gene: ENSMUSG00000033278
AA Change: K385I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
MAM 22 184 2.81e-73 SMART
IG 191 279 2.1e-6 SMART
FN3 281 364 6.35e-4 SMART
FN3 380 468 2.81e-5 SMART
FN3 482 572 3.7e-5 SMART
transmembrane domain 743 764 N/A INTRINSIC
low complexity region 765 774 N/A INTRINSIC
PTPc 899 1156 5.26e-135 SMART
PTPc 1185 1450 9.46e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223982
AA Change: K385I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000224091
AA Change: K385I

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000224862
AA Change: K125I

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.018 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP has been shown to mediate cell-cell aggregation through the interaction with another molecule of this PTP on an adjacent cell. This PTP can interact with scaffolding protein RACK1/GNB2L1, which may be necessary for the downstream signaling in response to cell-cell adhesion. Alternative splicing results in multiple transcripts encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired flow-induced dilation in mesenteric resistance arteries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,686,066 S2T probably benign Het
Abca3 C T 17: 24,408,122 R1266C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 V670D probably damaging Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
AY074887 T C 9: 54,950,818 probably benign Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Catspere1 A T 1: 177,879,782 noncoding transcript Het
Cnmd T C 14: 79,656,686 Q87R probably benign Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Cyp2d26 T C 15: 82,790,989 Q388R probably benign Het
Ddb1 A T 19: 10,622,364 T646S probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Dzank1 T C 2: 144,483,412 H545R probably damaging Het
Ehhadh T A 16: 21,766,511 M207L probably benign Het
Elmo2 T A 2: 165,291,707 probably benign Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Igsf21 T C 4: 140,028,067 T426A possibly damaging Het
Kcnf1 T C 12: 17,174,741 E493G probably benign Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Map3k20 A T 2: 72,438,214 T522S probably benign Het
Mpp5 T A 12: 78,820,815 M324K possibly damaging Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Msln T C 17: 25,752,983 M87V probably benign Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr292 A G 7: 86,695,232 K259E probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 probably benign Het
Pprc1 G T 19: 46,064,758 probably benign Het
Rfxap T A 3: 54,804,517 N215I probably damaging Het
Slc16a7 A T 10: 125,233,464 Y114* probably null Het
Smarcb1 G T 10: 75,911,794 probably benign Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Uba7 G A 9: 107,980,047 V703I probably benign Het
Upb1 T C 10: 75,412,804 S53P possibly damaging Het
Zfp672 A G 11: 58,316,851 S215P possibly damaging Het
Zfp978 T A 4: 147,390,980 L328H probably damaging Het
Other mutations in Ptprm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Ptprm APN 17 66817972 missense probably damaging 1.00
IGL01128:Ptprm APN 17 67042101 missense probably damaging 1.00
IGL01509:Ptprm APN 17 66762213 missense possibly damaging 0.95
IGL01785:Ptprm APN 17 66685623 missense probably damaging 1.00
IGL01912:Ptprm APN 17 67046118 missense probably benign 0.13
IGL01929:Ptprm APN 17 66690549 missense probably damaging 1.00
IGL01937:Ptprm APN 17 67046163 splice site probably benign
IGL01939:Ptprm APN 17 67063163 splice site probably benign
IGL02053:Ptprm APN 17 66693841 missense probably damaging 1.00
IGL02203:Ptprm APN 17 66953123 missense probably damaging 1.00
IGL02468:Ptprm APN 17 66814509 missense probably benign 0.02
IGL02500:Ptprm APN 17 66920048 missense probably damaging 0.99
IGL02542:Ptprm APN 17 66920150 missense probably benign
R0674:Ptprm UTSW 17 67191341 missense possibly damaging 0.52
R0709:Ptprm UTSW 17 66944332 splice site probably null
R1054:Ptprm UTSW 17 67042318 missense probably damaging 1.00
R1522:Ptprm UTSW 17 66693871 missense possibly damaging 0.91
R1561:Ptprm UTSW 17 66940541 missense probably damaging 1.00
R1726:Ptprm UTSW 17 67042327 missense probably damaging 1.00
R1744:Ptprm UTSW 17 66689366 missense probably damaging 1.00
R1873:Ptprm UTSW 17 66688355 missense probably damaging 1.00
R1951:Ptprm UTSW 17 66940580 missense probably benign 0.07
R1952:Ptprm UTSW 17 66940580 missense probably benign 0.07
R1953:Ptprm UTSW 17 66940580 missense probably benign 0.07
R1993:Ptprm UTSW 17 66747160 missense probably damaging 1.00
R2017:Ptprm UTSW 17 66957153 intron probably null
R2266:Ptprm UTSW 17 66725851 splice site probably null
R2417:Ptprm UTSW 17 66944326 missense probably damaging 0.97
R2511:Ptprm UTSW 17 66693778 missense probably damaging 1.00
R3726:Ptprm UTSW 17 66956860 missense possibly damaging 0.91
R3824:Ptprm UTSW 17 66809575 missense probably benign 0.40
R4057:Ptprm UTSW 17 67075663 missense possibly damaging 0.93
R4113:Ptprm UTSW 17 66725813 missense probably damaging 1.00
R4559:Ptprm UTSW 17 66683408 missense possibly damaging 0.74
R4598:Ptprm UTSW 17 67095497 missense probably benign 0.00
R4742:Ptprm UTSW 17 66744751 nonsense probably null
R4974:Ptprm UTSW 17 66678067 missense probably benign 0.01
R5433:Ptprm UTSW 17 66693473 missense probably damaging 1.00
R5509:Ptprm UTSW 17 66689358 missense probably damaging 1.00
R5586:Ptprm UTSW 17 66920196 missense probably damaging 1.00
R5820:Ptprm UTSW 17 66689465 missense probably damaging 1.00
R5867:Ptprm UTSW 17 67045981 splice site probably null
R6044:Ptprm UTSW 17 66693862 missense probably damaging 1.00
R6229:Ptprm UTSW 17 66688300 missense probably damaging 1.00
R6615:Ptprm UTSW 17 67353956 critical splice donor site probably null
R6969:Ptprm UTSW 17 66912418 missense possibly damaging 0.63
R7135:Ptprm UTSW 17 66944288 missense possibly damaging 0.93
R7161:Ptprm UTSW 17 66809627 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TGGGAGTTATCTGTATCCCAGC -3'
(R):5'- CTGAGGCACATAGTAAGTGTTCAG -3'

Sequencing Primer
(F):5'- GAGTTATCTGTATCCCAGCTCACTTC -3'
(R):5'- TTCTTGTGTGTCATTCACA -3'
Posted On2016-06-21