Incidental Mutation 'R5157:Pprc1'
ID396806
Institutional Source Beutler Lab
Gene Symbol Pprc1
Ensembl Gene ENSMUSG00000055491
Gene Nameperoxisome proliferative activated receptor, gamma, coactivator-related 1
Synonyms
MMRRC Submission 042739-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5157 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location46044886-46072915 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 46064758 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062322] [ENSMUST00000099392] [ENSMUST00000111899] [ENSMUST00000126127] [ENSMUST00000135327] [ENSMUST00000147640] [ENSMUST00000150158]
Predicted Effect unknown
Transcript: ENSMUST00000062322
AA Change: C909F
SMART Domains Protein: ENSMUSP00000079389
Gene: ENSMUSG00000055491
AA Change: C909F

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 214 240 N/A INTRINSIC
low complexity region 448 459 N/A INTRINSIC
low complexity region 516 525 N/A INTRINSIC
low complexity region 646 661 N/A INTRINSIC
low complexity region 732 739 N/A INTRINSIC
low complexity region 826 887 N/A INTRINSIC
low complexity region 915 925 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 1020 1033 N/A INTRINSIC
low complexity region 1224 1240 N/A INTRINSIC
low complexity region 1397 1446 N/A INTRINSIC
low complexity region 1453 1504 N/A INTRINSIC
RRM 1526 1597 3.36e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000099392
AA Change: C905F
SMART Domains Protein: ENSMUSP00000096990
Gene: ENSMUSG00000055491
AA Change: C905F

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 210 236 N/A INTRINSIC
low complexity region 444 455 N/A INTRINSIC
low complexity region 512 521 N/A INTRINSIC
low complexity region 642 657 N/A INTRINSIC
low complexity region 728 735 N/A INTRINSIC
low complexity region 822 883 N/A INTRINSIC
low complexity region 911 921 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 975 987 N/A INTRINSIC
low complexity region 1016 1029 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111899
AA Change: C908F
SMART Domains Protein: ENSMUSP00000107530
Gene: ENSMUSG00000055491
AA Change: C908F

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 213 239 N/A INTRINSIC
low complexity region 447 458 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 731 738 N/A INTRINSIC
low complexity region 825 886 N/A INTRINSIC
low complexity region 914 924 N/A INTRINSIC
low complexity region 938 959 N/A INTRINSIC
low complexity region 978 990 N/A INTRINSIC
low complexity region 1019 1032 N/A INTRINSIC
low complexity region 1222 1238 N/A INTRINSIC
low complexity region 1395 1444 N/A INTRINSIC
low complexity region 1451 1502 N/A INTRINSIC
RRM 1524 1595 3.36e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134015
Predicted Effect probably benign
Transcript: ENSMUST00000135327
Predicted Effect probably benign
Transcript: ENSMUST00000147640
Predicted Effect probably benign
Transcript: ENSMUST00000150158
SMART Domains Protein: ENSMUSP00000120475
Gene: ENSMUSG00000055491

DomainStartEndE-ValueType
low complexity region 70 86 N/A INTRINSIC
low complexity region 102 128 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153111
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to PPAR-gamma coactivator 1 (PPARGC1/PGC-1), a protein that can activate mitochondrial biogenesis in part through a direct interaction with nuclear respiratory factor 1 (NRF1). This protein has been shown to interact with NRF1. It is thought to be a functional relative of PPAR-gamma coactivator 1 that activates mitochondrial biogenesis through NRF1 in response to proliferative signals. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit letahlity post-implantation with delayed hatching and disorganized embryo tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik A T 11: 51,686,066 S2T probably benign Het
Abca3 C T 17: 24,408,122 R1266C probably damaging Het
Adap2 T C 11: 80,156,946 F76S probably damaging Het
Adgb T A 10: 10,398,966 H747L probably damaging Het
Aox1 T A 1: 58,070,063 V670D probably damaging Het
Ap4e1 A G 2: 127,061,695 D839G probably benign Het
Arhgef11 T A 3: 87,728,510 probably null Het
AY074887 T C 9: 54,950,818 probably benign Het
Bicd1 C G 6: 149,520,414 Q878E probably benign Het
Catspere1 A T 1: 177,879,782 noncoding transcript Het
Cnmd T C 14: 79,656,686 Q87R probably benign Het
Col24a1 G T 3: 145,345,951 G661* probably null Het
Crtap G A 9: 114,384,792 L232F probably damaging Het
Ctsq T C 13: 61,037,099 T258A probably benign Het
Cyp2d26 T C 15: 82,790,989 Q388R probably benign Het
Ddb1 A T 19: 10,622,364 T646S probably benign Het
Dnah6 G T 6: 73,195,634 S280R probably benign Het
Dzank1 T C 2: 144,483,412 H545R probably damaging Het
Ehhadh T A 16: 21,766,511 M207L probably benign Het
Elmo2 T A 2: 165,291,707 probably benign Het
Golga3 G A 5: 110,202,671 A731T probably benign Het
Igsf21 T C 4: 140,028,067 T426A possibly damaging Het
Kcnf1 T C 12: 17,174,741 E493G probably benign Het
Lmna A T 3: 88,484,107 D364E probably damaging Het
Lsr T C 7: 30,966,040 Y163C probably damaging Het
Map3k20 A T 2: 72,438,214 T522S probably benign Het
Mpp5 T A 12: 78,820,815 M324K possibly damaging Het
Mroh9 C A 1: 163,044,121 A598S probably damaging Het
Msln T C 17: 25,752,983 M87V probably benign Het
Olfr1155 T A 2: 87,942,888 M247L probably benign Het
Olfr1197 T A 2: 88,729,548 Q17L probably benign Het
Olfr292 A G 7: 86,695,232 K259E probably benign Het
Olfr385 T C 11: 73,589,723 N5S probably damaging Het
Plekhg5 T A 4: 152,107,865 probably benign Het
Ptprm T A 17: 66,957,097 K385I probably benign Het
Rfxap T A 3: 54,804,517 N215I probably damaging Het
Slc16a7 A T 10: 125,233,464 Y114* probably null Het
Smarcb1 G T 10: 75,911,794 probably benign Het
Spef2 T A 15: 9,668,791 R770* probably null Het
Stard9 A T 2: 120,697,861 Y1533F probably benign Het
Tbcd A T 11: 121,610,027 Y1142F probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Uba7 G A 9: 107,980,047 V703I probably benign Het
Upb1 T C 10: 75,412,804 S53P possibly damaging Het
Zfp672 A G 11: 58,316,851 S215P possibly damaging Het
Zfp978 T A 4: 147,390,980 L328H probably damaging Het
Other mutations in Pprc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pprc1 APN 19 46062648 missense possibly damaging 0.93
IGL00825:Pprc1 APN 19 46071406 unclassified probably benign
IGL01445:Pprc1 APN 19 46065232 unclassified probably benign
IGL01449:Pprc1 APN 19 46065232 unclassified probably benign
IGL01475:Pprc1 APN 19 46071529 missense probably benign 0.03
IGL01750:Pprc1 APN 19 46071829 unclassified probably benign
IGL01779:Pprc1 APN 19 46062202 missense probably damaging 1.00
IGL01943:Pprc1 APN 19 46064544 unclassified probably benign
IGL02031:Pprc1 APN 19 46072343 unclassified probably benign
IGL02145:Pprc1 APN 19 46064890 unclassified probably benign
IGL02206:Pprc1 APN 19 46071751 missense probably damaging 0.98
IGL02439:Pprc1 APN 19 46072319 missense possibly damaging 0.94
IGL02675:Pprc1 APN 19 46063507 missense probably damaging 1.00
IGL03185:Pprc1 APN 19 46069747 intron probably benign
IGL03325:Pprc1 APN 19 46061509 missense possibly damaging 0.86
R0125:Pprc1 UTSW 19 46069512 intron probably benign
R0388:Pprc1 UTSW 19 46062775 missense possibly damaging 0.85
R0498:Pprc1 UTSW 19 46071568 nonsense probably null
R1129:Pprc1 UTSW 19 46063806 missense probably benign 0.35
R1439:Pprc1 UTSW 19 46063736 missense possibly damaging 0.94
R1536:Pprc1 UTSW 19 46071526 unclassified probably benign
R4551:Pprc1 UTSW 19 46067225 unclassified probably benign
R4698:Pprc1 UTSW 19 46069195 intron probably benign
R4822:Pprc1 UTSW 19 46071356 unclassified probably benign
R4909:Pprc1 UTSW 19 46064319 missense probably damaging 0.99
R4931:Pprc1 UTSW 19 46071316 unclassified probably benign
R5132:Pprc1 UTSW 19 46072682 unclassified probably benign
R5834:Pprc1 UTSW 19 46065220 unclassified probably benign
R5938:Pprc1 UTSW 19 46071316 unclassified probably benign
R5947:Pprc1 UTSW 19 46063672 missense possibly damaging 0.85
R5975:Pprc1 UTSW 19 46065370 unclassified probably benign
R6009:Pprc1 UTSW 19 46071732 missense probably damaging 1.00
R6259:Pprc1 UTSW 19 46064410 missense probably damaging 0.97
R6954:Pprc1 UTSW 19 46064433 missense probably damaging 0.96
R7287:Pprc1 UTSW 19 46071354 missense unknown
Predicted Primers PCR Primer
(F):5'- CACTTGCAGTTAGACCACCC -3'
(R):5'- ATCCATAGGCACAGCTGGAG -3'

Sequencing Primer
(F):5'- GTCTGTGTCTCCTGCTGGAC -3'
(R):5'- GCTGTAAGGTGAAACTGGTGC -3'
Posted On2016-06-21