Incidental Mutation 'R5158:Mpl'
ID396822
Institutional Source Beutler Lab
Gene Symbol Mpl
Ensembl Gene ENSMUSG00000006389
Gene Namemyeloproliferative leukemia virus oncogene
SynonymsTPO-R, thrombopoietin receptor, c-mpl, hlb219, CD110, c-mpl-I, c-mpl-II
MMRRC Submission 042740-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5158 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118442415-118457513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 118456684 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 128 (D128A)
Ref Sequence ENSEMBL: ENSMUSP00000099732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006556] [ENSMUST00000102671] [ENSMUST00000106375]
Predicted Effect unknown
Transcript: ENSMUST00000006556
AA Change: D128A
SMART Domains Protein: ENSMUSP00000006556
Gene: ENSMUSG00000006389
AA Change: D128A

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 1.9e-31 PFAM
Pfam:IL6Ra-bind 27 118 1.8e-7 PFAM
FN3 126 257 7.7e-3 SMART
FN3 382 461 2.83e0 SMART
transmembrane domain 483 505 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102671
AA Change: D128A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099732
Gene: ENSMUSG00000006389
AA Change: D128A

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.4e-32 PFAM
Pfam:IL6Ra-bind 34 125 7.3e-9 PFAM
FN3 133 256 1.09e-2 SMART
FN3 381 460 2.83e0 SMART
transmembrane domain 482 504 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106375
AA Change: D121A

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101983
Gene: ENSMUSG00000006389
AA Change: D121A

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 9.4e-32 PFAM
Pfam:IL6Ra-bind 27 119 7.4e-8 PFAM
FN3 322 401 2.83e0 SMART
transmembrane domain 423 445 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000168404
AA Change: D127A
SMART Domains Protein: ENSMUSP00000130167
Gene: ENSMUSG00000006389
AA Change: D127A

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.9e-31 PFAM
FN3 133 264 7.7e-3 SMART
FN3 389 468 2.83e0 SMART
transmembrane domain 490 512 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216417
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In 1990 an oncogene, v-mpl, was identified from the murine myeloproliferative leukemia virus that was capable of immortalizing bone marrow hematopoietic cells from different lineages. In 1992 the human homologue, named, c-mpl, was cloned. Sequence data revealed that c-mpl encoded a protein that was homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. The ligand for c-mpl, thrombopoietin, was cloned in 1994. Thrombopoietin was shown to be the major regulator of megakaryocytopoiesis and platelet formation. The protein encoded by the c-mpl gene, CD110, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs . TPO-R deficient mice were severely thrombocytopenic, emphasizing the important role of CD110 and thrombopoietin in megakaryocyte and platelet formation. Upon binding of thrombopoietin CD110 is dimerized and the JAK family of non-receptor tyrosine kinases, as well as the STAT family, the MAPK family, the adaptor protein Shc and the receptors themselves become tyrosine phosphorylated. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations at this locus are unable to produce normal amounts of megakaryocytes and platelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C T 17: 45,514,829 T357I probably benign Het
Abca14 A T 7: 120,253,429 R872S probably benign Het
Adnp2 A G 18: 80,137,543 Y47H probably damaging Het
Atp6v0d2 T C 4: 19,878,292 N327S probably damaging Het
Ccdc190 A G 1: 169,933,009 R69G probably benign Het
Cfap54 T C 10: 93,065,197 D213G probably damaging Het
Clcn4 G A 7: 7,291,619 T381I possibly damaging Het
Cobl A G 11: 12,256,198 F477S possibly damaging Het
Ctdspl2 T A 2: 121,981,293 V205E probably benign Het
Dhx37 A T 5: 125,415,152 Y1128N probably damaging Het
Ehmt2 G A 17: 34,911,664 E1085K probably damaging Het
Fam149a T G 8: 45,350,435 I340L possibly damaging Het
Fut9 T A 4: 25,620,731 I28F probably benign Het
Il1f9 T A 2: 24,192,786 I191K probably damaging Het
Iqgap1 T C 7: 80,743,068 N716D probably benign Het
Itgb7 T C 15: 102,217,029 D672G probably benign Het
Kat6b A G 14: 21,669,986 M1469V possibly damaging Het
Kif3a T C 11: 53,588,751 F430L probably benign Het
L3mbtl3 T C 10: 26,303,688 D523G unknown Het
Mcf2l A G 8: 13,009,715 Q736R probably damaging Het
Myom3 T A 4: 135,765,586 C149S probably damaging Het
N4bp2 A G 5: 65,808,462 I1285V probably damaging Het
Nalcn T C 14: 123,515,737 Q279R probably damaging Het
Ndc1 T G 4: 107,375,165 S182R probably damaging Het
Ngf A T 3: 102,520,129 M65L possibly damaging Het
Olfr134 T A 17: 38,175,454 Y123* probably null Het
Pigb T C 9: 73,022,401 Y300C probably damaging Het
Pla2g2a T G 4: 138,833,284 *69G probably null Het
Ppp1r12b T C 1: 134,886,428 E379G probably damaging Het
Ptdss2 T C 7: 141,151,771 F164S probably benign Het
Ptprc T C 1: 138,175,084 T2A possibly damaging Het
Ptprq T A 10: 107,534,704 N2042I probably damaging Het
Rdh10 A T 1: 16,107,997 R164S probably damaging Het
Sec31a A T 5: 100,393,321 I309N probably damaging Het
Skint5 A T 4: 113,742,212 I710N unknown Het
Slc25a30 A T 14: 75,771,516 L26Q probably damaging Het
Sptan1 G A 2: 29,978,443 V34I probably damaging Het
Sult1e1 A T 5: 87,587,594 I75N probably damaging Het
Trpa1 A G 1: 14,881,661 V938A probably benign Het
Vps16 C T 2: 130,441,279 R531C probably damaging Het
Zbtb22 C T 17: 33,918,449 H523Y probably damaging Het
Zfp39 G A 11: 58,889,845 T697M possibly damaging Het
Other mutations in Mpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Mpl APN 4 118455661 missense possibly damaging 0.94
IGL02096:Mpl APN 4 118457136 missense possibly damaging 0.46
IGL02681:Mpl APN 4 118448871 splice site probably benign
R0238:Mpl UTSW 4 118456863 splice site probably benign
R0309:Mpl UTSW 4 118446038 intron probably benign
R0539:Mpl UTSW 4 118443508 missense possibly damaging 0.68
R0558:Mpl UTSW 4 118444020 missense probably damaging 0.99
R0601:Mpl UTSW 4 118443536 missense probably benign 0.08
R0784:Mpl UTSW 4 118446406 missense possibly damaging 0.59
R1016:Mpl UTSW 4 118448913 missense probably damaging 1.00
R1532:Mpl UTSW 4 118448568 missense possibly damaging 0.63
R1590:Mpl UTSW 4 118444024 missense probably damaging 0.99
R1806:Mpl UTSW 4 118443532 missense possibly damaging 0.73
R1875:Mpl UTSW 4 118456829 missense probably benign
R1935:Mpl UTSW 4 118455739 missense probably benign 0.01
R2182:Mpl UTSW 4 118457413 missense probably benign
R2291:Mpl UTSW 4 118449000 missense probably benign 0.04
R2508:Mpl UTSW 4 118455757 missense probably damaging 1.00
R4242:Mpl UTSW 4 118456771 missense probably damaging 0.98
R4718:Mpl UTSW 4 118456724 missense probably benign 0.02
R4775:Mpl UTSW 4 118448580 missense probably damaging 1.00
R5208:Mpl UTSW 4 118455881 missense probably benign 0.00
R5276:Mpl UTSW 4 118455721 missense probably benign
R5953:Mpl UTSW 4 118454510 missense possibly damaging 0.89
R5953:Mpl UTSW 4 118454511 missense probably damaging 0.99
R6439:Mpl UTSW 4 118448553 missense probably damaging 0.98
R6450:Mpl UTSW 4 118448700 splice site probably null
R6521:Mpl UTSW 4 118455117 critical splice donor site probably null
R6812:Mpl UTSW 4 118455264 missense probably benign 0.03
R6876:Mpl UTSW 4 118457120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTTCCAGATGCCAAGGC -3'
(R):5'- AAATTGGGCATGGTTTCAGCC -3'

Sequencing Primer
(F):5'- TTCCAGATGCCAAGGCTAGGATG -3'
(R):5'- TCCTCAGAGCTGAACATGATGACTG -3'
Posted On2016-06-21