Incidental Mutation 'R5158:Clcn4'
ID 396830
Institutional Source Beutler Lab
Gene Symbol Clcn4
Ensembl Gene ENSMUSG00000000605
Gene Name chloride channel, voltage-sensitive 4
Synonyms Clc4-2, Clcn4-2
MMRRC Submission 042740-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5158 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 7285308-7303837 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 7294618 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 381 (T381I)
Ref Sequence ENSEMBL: ENSMUSP00000000619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000619] [ENSMUST00000209916] [ENSMUST00000210061] [ENSMUST00000210362] [ENSMUST00000210594] [ENSMUST00000211574]
AlphaFold Q61418
Predicted Effect possibly damaging
Transcript: ENSMUST00000000619
AA Change: T381I

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000000619
Gene: ENSMUSG00000000605
AA Change: T381I

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
Pfam:Voltage_CLC 149 552 2.7e-111 PFAM
CBS 596 646 1.07e-1 SMART
CBS 687 734 4.92e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209916
Predicted Effect possibly damaging
Transcript: ENSMUST00000210061
AA Change: T350I

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210318
Predicted Effect probably benign
Transcript: ENSMUST00000210362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210444
Predicted Effect possibly damaging
Transcript: ENSMUST00000210594
AA Change: T321I

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000211574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211551
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. Chloride channel 4 has an evolutionary conserved CpG island and is conserved in both mouse and hamster. This gene is mapped in close proximity to APXL (Apical protein Xenopus laevis-like) and OA1 (Ocular albinism type I), which are both located on the human X chromosome at band p22.3. The physiological role of chloride channel 4 remains unknown but may contribute to the pathogenesis of neuronal disorders. Alternate splicing results in two transcript variants that encode different proteins. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C T 17: 45,825,755 (GRCm39) T357I probably benign Het
Abca14 A T 7: 119,852,652 (GRCm39) R872S probably benign Het
Adnp2 A G 18: 80,180,758 (GRCm39) Y47H probably damaging Het
Atp6v0d2 T C 4: 19,878,292 (GRCm39) N327S probably damaging Het
Ccdc190 A G 1: 169,760,578 (GRCm39) R69G probably benign Het
Cfap54 T C 10: 92,901,059 (GRCm39) D213G probably damaging Het
Cobl A G 11: 12,206,198 (GRCm39) F477S possibly damaging Het
Ctdspl2 T A 2: 121,811,774 (GRCm39) V205E probably benign Het
Dhx37 A T 5: 125,492,216 (GRCm39) Y1128N probably damaging Het
Ehmt2 G A 17: 35,130,640 (GRCm39) E1085K probably damaging Het
Fam149a T G 8: 45,803,472 (GRCm39) I340L possibly damaging Het
Fut9 T A 4: 25,620,731 (GRCm39) I28F probably benign Het
Il36g T A 2: 24,082,798 (GRCm39) I191K probably damaging Het
Iqgap1 T C 7: 80,392,816 (GRCm39) N716D probably benign Het
Itgb7 T C 15: 102,125,464 (GRCm39) D672G probably benign Het
Kat6b A G 14: 21,720,054 (GRCm39) M1469V possibly damaging Het
Kif3a T C 11: 53,479,578 (GRCm39) F430L probably benign Het
L3mbtl3 T C 10: 26,179,586 (GRCm39) D523G unknown Het
Mcf2l A G 8: 13,059,715 (GRCm39) Q736R probably damaging Het
Mpl T G 4: 118,313,881 (GRCm39) D128A probably damaging Het
Myom3 T A 4: 135,492,897 (GRCm39) C149S probably damaging Het
N4bp2 A G 5: 65,965,805 (GRCm39) I1285V probably damaging Het
Nalcn T C 14: 123,753,149 (GRCm39) Q279R probably damaging Het
Ndc1 T G 4: 107,232,362 (GRCm39) S182R probably damaging Het
Ngf A T 3: 102,427,445 (GRCm39) M65L possibly damaging Het
Or2n1 T A 17: 38,486,345 (GRCm39) Y123* probably null Het
Pigb T C 9: 72,929,683 (GRCm39) Y300C probably damaging Het
Pla2g2a T G 4: 138,560,595 (GRCm39) *69G probably null Het
Ppp1r12b T C 1: 134,814,166 (GRCm39) E379G probably damaging Het
Ptdss2 T C 7: 140,731,684 (GRCm39) F164S probably benign Het
Ptprc T C 1: 138,102,822 (GRCm39) T2A possibly damaging Het
Ptprq T A 10: 107,370,565 (GRCm39) N2042I probably damaging Het
Rdh10 A T 1: 16,178,221 (GRCm39) R164S probably damaging Het
Sec31a A T 5: 100,541,180 (GRCm39) I309N probably damaging Het
Skint5 A T 4: 113,599,409 (GRCm39) I710N unknown Het
Slc25a30 A T 14: 76,008,956 (GRCm39) L26Q probably damaging Het
Sptan1 G A 2: 29,868,455 (GRCm39) V34I probably damaging Het
Sult1e1 A T 5: 87,735,453 (GRCm39) I75N probably damaging Het
Trpa1 A G 1: 14,951,885 (GRCm39) V938A probably benign Het
Vps16 C T 2: 130,283,199 (GRCm39) R531C probably damaging Het
Zbtb22 C T 17: 34,137,423 (GRCm39) H523Y probably damaging Het
Zfp39 G A 11: 58,780,671 (GRCm39) T697M possibly damaging Het
Other mutations in Clcn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Clcn4 APN 7 7,290,672 (GRCm39) missense probably damaging 0.99
IGL01090:Clcn4 APN 7 7,297,035 (GRCm39) missense probably benign 0.01
IGL01650:Clcn4 APN 7 7,287,280 (GRCm39) splice site probably benign
IGL02404:Clcn4 APN 7 7,290,857 (GRCm39) missense probably benign 0.04
IGL02493:Clcn4 APN 7 7,287,243 (GRCm39) missense probably damaging 1.00
IGL02556:Clcn4 APN 7 7,299,065 (GRCm39) missense probably benign
IGL02661:Clcn4 APN 7 7,294,730 (GRCm39) splice site probably null
IGL02816:Clcn4 APN 7 7,298,087 (GRCm39) missense probably damaging 1.00
IGL02882:Clcn4 APN 7 7,293,464 (GRCm39) missense probably damaging 1.00
IGL03205:Clcn4 APN 7 7,293,419 (GRCm39) missense probably damaging 1.00
IGL03289:Clcn4 APN 7 7,287,257 (GRCm39) missense probably damaging 1.00
Delipidated UTSW 7 7,296,060 (GRCm39) missense probably damaging 1.00
R0183:Clcn4 UTSW 7 7,298,090 (GRCm39) nonsense probably null
R0379:Clcn4 UTSW 7 7,299,791 (GRCm39) missense probably damaging 0.99
R0555:Clcn4 UTSW 7 7,293,503 (GRCm39) missense possibly damaging 0.65
R0890:Clcn4 UTSW 7 7,291,964 (GRCm39) missense possibly damaging 0.89
R1463:Clcn4 UTSW 7 7,299,763 (GRCm39) nonsense probably null
R1549:Clcn4 UTSW 7 7,294,681 (GRCm39) missense probably damaging 1.00
R1563:Clcn4 UTSW 7 7,296,981 (GRCm39) missense probably damaging 1.00
R1966:Clcn4 UTSW 7 7,287,184 (GRCm39) makesense probably null
R2764:Clcn4 UTSW 7 7,299,798 (GRCm39) missense possibly damaging 0.81
R2874:Clcn4 UTSW 7 7,293,520 (GRCm39) missense probably benign 0.33
R4023:Clcn4 UTSW 7 7,293,427 (GRCm39) missense probably damaging 1.00
R4024:Clcn4 UTSW 7 7,293,427 (GRCm39) missense probably damaging 1.00
R4152:Clcn4 UTSW 7 7,297,833 (GRCm39) missense probably benign 0.02
R4154:Clcn4 UTSW 7 7,297,833 (GRCm39) missense probably benign 0.02
R4298:Clcn4 UTSW 7 7,299,737 (GRCm39) missense possibly damaging 0.93
R4535:Clcn4 UTSW 7 7,290,813 (GRCm39) missense probably benign 0.01
R4574:Clcn4 UTSW 7 7,290,804 (GRCm39) missense probably benign 0.23
R4977:Clcn4 UTSW 7 7,294,436 (GRCm39) missense probably benign 0.00
R5302:Clcn4 UTSW 7 7,297,050 (GRCm39) missense possibly damaging 0.95
R5369:Clcn4 UTSW 7 7,299,032 (GRCm39) missense probably benign 0.26
R5624:Clcn4 UTSW 7 7,291,943 (GRCm39) missense probably benign 0.35
R5626:Clcn4 UTSW 7 7,292,017 (GRCm39) missense probably damaging 1.00
R5723:Clcn4 UTSW 7 7,294,681 (GRCm39) missense probably damaging 1.00
R6154:Clcn4 UTSW 7 7,294,481 (GRCm39) missense probably benign 0.00
R6259:Clcn4 UTSW 7 7,294,529 (GRCm39) missense possibly damaging 0.92
R6396:Clcn4 UTSW 7 7,297,024 (GRCm39) missense probably damaging 1.00
R6783:Clcn4 UTSW 7 7,302,181 (GRCm39) unclassified probably benign
R7320:Clcn4 UTSW 7 7,294,827 (GRCm39) missense probably benign 0.19
R7562:Clcn4 UTSW 7 7,298,081 (GRCm39) missense possibly damaging 0.92
R7586:Clcn4 UTSW 7 7,296,958 (GRCm39) missense probably benign 0.00
R7752:Clcn4 UTSW 7 7,296,936 (GRCm39) missense probably benign
R7860:Clcn4 UTSW 7 7,296,060 (GRCm39) missense probably damaging 1.00
R7872:Clcn4 UTSW 7 7,290,780 (GRCm39) missense probably benign
R7895:Clcn4 UTSW 7 7,298,167 (GRCm39) missense probably benign 0.26
R8069:Clcn4 UTSW 7 7,299,758 (GRCm39) missense probably damaging 0.99
R8083:Clcn4 UTSW 7 7,294,427 (GRCm39) missense possibly damaging 0.69
R9185:Clcn4 UTSW 7 7,287,197 (GRCm39) missense possibly damaging 0.74
R9281:Clcn4 UTSW 7 7,294,813 (GRCm39) missense probably benign 0.16
R9333:Clcn4 UTSW 7 7,292,192 (GRCm39) missense probably damaging 1.00
R9682:Clcn4 UTSW 7 7,299,797 (GRCm39) missense probably benign 0.02
X0019:Clcn4 UTSW 7 7,294,609 (GRCm39) missense probably damaging 1.00
Z1177:Clcn4 UTSW 7 7,297,755 (GRCm39) missense probably damaging 0.96
Z1177:Clcn4 UTSW 7 7,296,039 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGATCAGTGCCAAGGCCAG -3'
(R):5'- TGGAAATAGCCGCCTGGTTC -3'

Sequencing Primer
(F):5'- CTGTGTAAACTCCAACCC -3'
(R):5'- GTGGAGTATCATACACCCTGGTAC -3'
Posted On 2016-06-21