Incidental Mutation 'R5158:Ptdss2'
ID396834
Institutional Source Beutler Lab
Gene Symbol Ptdss2
Ensembl Gene ENSMUSG00000025495
Gene Namephosphatidylserine synthase 2
SynonymsPSS2
MMRRC Submission 042740-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R5158 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141122382-141157606 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141151771 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 164 (F164S)
Ref Sequence ENSEMBL: ENSMUSP00000026568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026568] [ENSMUST00000172479] [ENSMUST00000172787] [ENSMUST00000209928]
Predicted Effect probably benign
Transcript: ENSMUST00000026568
AA Change: F164S

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000026568
Gene: ENSMUSG00000025495
AA Change: F164S

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
transmembrane domain 73 90 N/A INTRINSIC
Pfam:PSS 98 378 1.8e-113 PFAM
transmembrane domain 388 410 N/A INTRINSIC
low complexity region 438 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172479
Predicted Effect probably benign
Transcript: ENSMUST00000172787
AA Change: F126S

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000133352
Gene: ENSMUSG00000025495
AA Change: F126S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 35 52 N/A INTRINSIC
Pfam:PSS 60 191 7.3e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174706
Predicted Effect probably benign
Transcript: ENSMUST00000209928
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the conversion of phosphatidylethanolamine to phosphatidylserine, a structural membrane phospholipid that functions in cell signaling, blood coagulation, and apoptosis. The encoded enzyme also has a high affinity for docosahexaenoic acid (DHA) and can use it to make DHA-containing phosphatidylserine. [provided by RefSeq, Jul 2016]
PHENOTYPE: Disruption of this gene causes infertility in about 10% of homozygous males. The remaining males and all females were fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C T 17: 45,514,829 T357I probably benign Het
Abca14 A T 7: 120,253,429 R872S probably benign Het
Adnp2 A G 18: 80,137,543 Y47H probably damaging Het
Atp6v0d2 T C 4: 19,878,292 N327S probably damaging Het
Ccdc190 A G 1: 169,933,009 R69G probably benign Het
Cfap54 T C 10: 93,065,197 D213G probably damaging Het
Clcn4 G A 7: 7,291,619 T381I possibly damaging Het
Cobl A G 11: 12,256,198 F477S possibly damaging Het
Ctdspl2 T A 2: 121,981,293 V205E probably benign Het
Dhx37 A T 5: 125,415,152 Y1128N probably damaging Het
Ehmt2 G A 17: 34,911,664 E1085K probably damaging Het
Fam149a T G 8: 45,350,435 I340L possibly damaging Het
Fut9 T A 4: 25,620,731 I28F probably benign Het
Il1f9 T A 2: 24,192,786 I191K probably damaging Het
Iqgap1 T C 7: 80,743,068 N716D probably benign Het
Itgb7 T C 15: 102,217,029 D672G probably benign Het
Kat6b A G 14: 21,669,986 M1469V possibly damaging Het
Kif3a T C 11: 53,588,751 F430L probably benign Het
L3mbtl3 T C 10: 26,303,688 D523G unknown Het
Mcf2l A G 8: 13,009,715 Q736R probably damaging Het
Mpl T G 4: 118,456,684 D128A probably damaging Het
Myom3 T A 4: 135,765,586 C149S probably damaging Het
N4bp2 A G 5: 65,808,462 I1285V probably damaging Het
Nalcn T C 14: 123,515,737 Q279R probably damaging Het
Ndc1 T G 4: 107,375,165 S182R probably damaging Het
Ngf A T 3: 102,520,129 M65L possibly damaging Het
Olfr134 T A 17: 38,175,454 Y123* probably null Het
Pigb T C 9: 73,022,401 Y300C probably damaging Het
Pla2g2a T G 4: 138,833,284 *69G probably null Het
Ppp1r12b T C 1: 134,886,428 E379G probably damaging Het
Ptprc T C 1: 138,175,084 T2A possibly damaging Het
Ptprq T A 10: 107,534,704 N2042I probably damaging Het
Rdh10 A T 1: 16,107,997 R164S probably damaging Het
Sec31a A T 5: 100,393,321 I309N probably damaging Het
Skint5 A T 4: 113,742,212 I710N unknown Het
Slc25a30 A T 14: 75,771,516 L26Q probably damaging Het
Sptan1 G A 2: 29,978,443 V34I probably damaging Het
Sult1e1 A T 5: 87,587,594 I75N probably damaging Het
Trpa1 A G 1: 14,881,661 V938A probably benign Het
Vps16 C T 2: 130,441,279 R531C probably damaging Het
Zbtb22 C T 17: 33,918,449 H523Y probably damaging Het
Zfp39 G A 11: 58,889,845 T697M possibly damaging Het
Other mutations in Ptdss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Ptdss2 APN 7 141143125 missense probably benign 0.35
IGL01860:Ptdss2 APN 7 141152836 missense probably damaging 1.00
IGL01966:Ptdss2 APN 7 141135391 missense possibly damaging 0.66
IGL02606:Ptdss2 APN 7 141152998 nonsense probably null
R0105:Ptdss2 UTSW 7 141152880 missense probably damaging 1.00
R0138:Ptdss2 UTSW 7 141155319 splice site probably benign
R0503:Ptdss2 UTSW 7 141151797 unclassified probably benign
R2397:Ptdss2 UTSW 7 141147092 missense probably benign 0.02
R3120:Ptdss2 UTSW 7 141152219 missense probably damaging 1.00
R4519:Ptdss2 UTSW 7 141154578 missense probably benign 0.30
R4728:Ptdss2 UTSW 7 141154459 missense probably benign 0.30
R6186:Ptdss2 UTSW 7 141154949 unclassified probably benign
R6464:Ptdss2 UTSW 7 141152211 missense probably damaging 1.00
R6580:Ptdss2 UTSW 7 141153012 missense probably damaging 1.00
R7290:Ptdss2 UTSW 7 141151780 missense possibly damaging 0.58
R7307:Ptdss2 UTSW 7 141151732 missense possibly damaging 0.51
R7444:Ptdss2 UTSW 7 141153084 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATCCAGGCTGCCTTGCTAAG -3'
(R):5'- GTGTGCTGCTTCAGATGACC -3'

Sequencing Primer
(F):5'- TTGCTAAGCCTCACCACACTAATG -3'
(R):5'- TGCTTCAGATGACCACACTGG -3'
Posted On2016-06-21