Incidental Mutation 'R5158:Adnp2'
ID396854
Institutional Source Beutler Lab
Gene Symbol Adnp2
Ensembl Gene ENSMUSG00000053950
Gene NameADNP homeobox 2
SynonymsZfp508, 8430420L05Rik
MMRRC Submission 042740-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5158 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location80126311-80151482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80137543 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 47 (Y47H)
Ref Sequence ENSEMBL: ENSMUSP00000068560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066743]
Predicted Effect probably damaging
Transcript: ENSMUST00000066743
AA Change: Y47H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068560
Gene: ENSMUSG00000053950
AA Change: Y47H

DomainStartEndE-ValueType
ZnF_C2H2 73 96 4.57e0 SMART
ZnF_C2H2 106 128 1.06e2 SMART
ZnF_C2H2 155 178 5.48e0 SMART
ZnF_C2H2 215 240 7.29e0 SMART
low complexity region 277 290 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 333 355 N/A INTRINSIC
low complexity region 545 567 N/A INTRINSIC
low complexity region 625 648 N/A INTRINSIC
low complexity region 656 674 N/A INTRINSIC
ZnF_C2H2 696 718 9.96e0 SMART
ZnF_C2H2 724 746 4.99e1 SMART
low complexity region 747 761 N/A INTRINSIC
ZnF_C2H2 777 798 1.93e2 SMART
ZnF_C2H2 800 823 4.34e0 SMART
ZnF_C2H2 905 928 5.81e-2 SMART
HOX 1073 1135 3.25e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C T 17: 45,514,829 T357I probably benign Het
Abca14 A T 7: 120,253,429 R872S probably benign Het
Atp6v0d2 T C 4: 19,878,292 N327S probably damaging Het
Ccdc190 A G 1: 169,933,009 R69G probably benign Het
Cfap54 T C 10: 93,065,197 D213G probably damaging Het
Clcn4 G A 7: 7,291,619 T381I possibly damaging Het
Cobl A G 11: 12,256,198 F477S possibly damaging Het
Ctdspl2 T A 2: 121,981,293 V205E probably benign Het
Dhx37 A T 5: 125,415,152 Y1128N probably damaging Het
Ehmt2 G A 17: 34,911,664 E1085K probably damaging Het
Fam149a T G 8: 45,350,435 I340L possibly damaging Het
Fut9 T A 4: 25,620,731 I28F probably benign Het
Il1f9 T A 2: 24,192,786 I191K probably damaging Het
Iqgap1 T C 7: 80,743,068 N716D probably benign Het
Itgb7 T C 15: 102,217,029 D672G probably benign Het
Kat6b A G 14: 21,669,986 M1469V possibly damaging Het
Kif3a T C 11: 53,588,751 F430L probably benign Het
L3mbtl3 T C 10: 26,303,688 D523G unknown Het
Mcf2l A G 8: 13,009,715 Q736R probably damaging Het
Mpl T G 4: 118,456,684 D128A probably damaging Het
Myom3 T A 4: 135,765,586 C149S probably damaging Het
N4bp2 A G 5: 65,808,462 I1285V probably damaging Het
Nalcn T C 14: 123,515,737 Q279R probably damaging Het
Ndc1 T G 4: 107,375,165 S182R probably damaging Het
Ngf A T 3: 102,520,129 M65L possibly damaging Het
Olfr134 T A 17: 38,175,454 Y123* probably null Het
Pigb T C 9: 73,022,401 Y300C probably damaging Het
Pla2g2a T G 4: 138,833,284 *69G probably null Het
Ppp1r12b T C 1: 134,886,428 E379G probably damaging Het
Ptdss2 T C 7: 141,151,771 F164S probably benign Het
Ptprc T C 1: 138,175,084 T2A possibly damaging Het
Ptprq T A 10: 107,534,704 N2042I probably damaging Het
Rdh10 A T 1: 16,107,997 R164S probably damaging Het
Sec31a A T 5: 100,393,321 I309N probably damaging Het
Skint5 A T 4: 113,742,212 I710N unknown Het
Slc25a30 A T 14: 75,771,516 L26Q probably damaging Het
Sptan1 G A 2: 29,978,443 V34I probably damaging Het
Sult1e1 A T 5: 87,587,594 I75N probably damaging Het
Trpa1 A G 1: 14,881,661 V938A probably benign Het
Vps16 C T 2: 130,441,279 R531C probably damaging Het
Zbtb22 C T 17: 33,918,449 H523Y probably damaging Het
Zfp39 G A 11: 58,889,845 T697M possibly damaging Het
Other mutations in Adnp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Adnp2 APN 18 80128867 missense probably benign 0.00
IGL00730:Adnp2 APN 18 80128032 missense probably benign
IGL01615:Adnp2 APN 18 80128477 missense probably damaging 1.00
IGL01681:Adnp2 APN 18 80127888 missense probably damaging 1.00
IGL02549:Adnp2 APN 18 80129118 missense probably damaging 1.00
R0003:Adnp2 UTSW 18 80130990 missense probably damaging 1.00
R0003:Adnp2 UTSW 18 80130990 missense probably damaging 1.00
R0013:Adnp2 UTSW 18 80129745 missense probably damaging 0.99
R0013:Adnp2 UTSW 18 80129745 missense probably damaging 0.99
R0325:Adnp2 UTSW 18 80130653 missense probably benign 0.06
R0478:Adnp2 UTSW 18 80129334 missense probably benign 0.31
R0545:Adnp2 UTSW 18 80129401 missense probably benign 0.31
R0788:Adnp2 UTSW 18 80130004 missense probably benign
R1756:Adnp2 UTSW 18 80127697 makesense probably null
R2043:Adnp2 UTSW 18 80128326 missense probably damaging 1.00
R2121:Adnp2 UTSW 18 80129170 missense probably benign 0.00
R2260:Adnp2 UTSW 18 80128449 missense probably benign 0.01
R2374:Adnp2 UTSW 18 80130987 missense probably damaging 1.00
R3416:Adnp2 UTSW 18 80128158 missense possibly damaging 0.55
R3607:Adnp2 UTSW 18 80129069 missense probably damaging 1.00
R4012:Adnp2 UTSW 18 80130821 missense probably benign 0.01
R4260:Adnp2 UTSW 18 80137527 missense possibly damaging 0.85
R4588:Adnp2 UTSW 18 80128648 missense probably benign 0.22
R5652:Adnp2 UTSW 18 80130850 missense probably damaging 1.00
R5717:Adnp2 UTSW 18 80128264 missense probably benign 0.13
R6743:Adnp2 UTSW 18 80128059 missense probably benign 0.00
R6786:Adnp2 UTSW 18 80129745 missense probably benign 0.03
R6903:Adnp2 UTSW 18 80130090 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGACTCTAGTGCCACTTCC -3'
(R):5'- CGCTGAGCCTCATGGTCTAATG -3'

Sequencing Primer
(F):5'- AGTGCCACTTCCTCCCAC -3'
(R):5'- ACAAGGTGCTAAGTTGCCC -3'
Posted On2016-06-21