Incidental Mutation 'R5159:Col5a2'
ID396856
Institutional Source Beutler Lab
Gene Symbol Col5a2
Ensembl Gene ENSMUSG00000026042
Gene Namecollagen, type V, alpha 2
Synonyms1110014L14Rik
MMRRC Submission 042741-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5159 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location45374321-45503282 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 45386831 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000083620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086430]
Predicted Effect probably null
Transcript: ENSMUST00000086430
SMART Domains Protein: ENSMUSP00000083620
Gene: ENSMUSG00000026042

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 40 95 9.94e-23 SMART
Pfam:Collagen 123 186 1.5e-10 PFAM
Pfam:Collagen 207 272 2.9e-9 PFAM
low complexity region 319 347 N/A INTRINSIC
internal_repeat_1 349 421 3.18e-18 PROSPERO
internal_repeat_2 385 422 1.34e-12 PROSPERO
internal_repeat_5 388 423 1.55e-7 PROSPERO
low complexity region 424 460 N/A INTRINSIC
low complexity region 471 508 N/A INTRINSIC
internal_repeat_6 509 535 5.68e-7 PROSPERO
internal_repeat_2 511 548 1.34e-12 PROSPERO
internal_repeat_3 520 549 1.16e-11 PROSPERO
internal_repeat_1 520 571 3.18e-18 PROSPERO
internal_repeat_4 546 574 4.91e-9 PROSPERO
low complexity region 595 611 N/A INTRINSIC
internal_repeat_7 616 741 1.35e-6 PROSPERO
low complexity region 742 757 N/A INTRINSIC
Pfam:Collagen 790 870 4.8e-8 PFAM
low complexity region 877 898 N/A INTRINSIC
Pfam:Collagen 907 979 4.2e-8 PFAM
internal_repeat_4 993 1021 4.91e-9 PROSPERO
internal_repeat_3 994 1023 1.16e-11 PROSPERO
low complexity region 1024 1054 N/A INTRINSIC
internal_repeat_6 1055 1078 5.68e-7 PROSPERO
low complexity region 1081 1096 N/A INTRINSIC
Pfam:Collagen 1111 1171 9.7e-12 PFAM
Pfam:Collagen 1168 1230 1.4e-9 PFAM
COLFI 1263 1497 1.83e-164 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150143
Meta Mutation Damage Score 0.494 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of type V collagen, one of the low abundance fibrillar collagens that gets incorporated into growing fibrils with type I collagen. The encoded protein, in association with alpha-1 and/or alpha-3 subunits, forms homo- or heterotrimeric type V procollagen that undergoes proteolytic processing. Mice lacking the encoded protein die in utero. Transgenic mice that produce a structurally abnormal form of the encoded protein survive poorly and exhibit skin fragility, skeletal abnormalities and alterations in the collagen fiber organization. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant animals exhibit reduced body weight, reduced bone growth rate, thin, fragile skin, variable degrees of lordosis and kyphosis, abnormal localization of hair follicles in the dermis, and thinned stroma of the cornea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,153,308 M1340K probably benign Het
9930111J21Rik1 T C 11: 48,948,525 T412A probably benign Het
Aldh5a1 T A 13: 24,913,793 M420L possibly damaging Het
Armc2 A G 10: 42,008,715 S77P probably damaging Het
Avil A G 10: 127,020,448 probably null Het
Bmp5 T A 9: 75,893,753 F388L probably damaging Het
Brca2 T G 5: 150,542,108 V1779G possibly damaging Het
Cblb T A 16: 52,112,120 S147T probably damaging Het
Cblc T C 7: 19,785,308 E409G probably benign Het
Cdc34b C T 11: 94,742,060 R29W probably damaging Het
Clic6 T A 16: 92,528,066 Y371N probably benign Het
Coro1a A T 7: 126,703,049 V42D probably damaging Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Crb1 A C 1: 139,243,018 V817G probably damaging Het
Cyp2c39 A G 19: 39,560,934 T299A possibly damaging Het
Dock5 G A 14: 67,792,289 R1019C probably benign Het
Exoc8 T C 8: 124,896,213 T472A probably benign Het
Fancc A G 13: 63,321,865 probably null Het
Inpp5d T C 1: 87,676,342 L244P probably damaging Het
Ireb2 A G 9: 54,892,547 N424S probably benign Het
Krt35 T C 11: 100,094,049 D261G probably damaging Het
Lipc T A 9: 70,812,910 I272L probably benign Het
Lpcat3 A G 6: 124,699,394 probably benign Het
Lzts1 T C 8: 69,138,584 D304G probably benign Het
Mdn1 A G 4: 32,774,008 I5540V possibly damaging Het
Msln T C 17: 25,751,589 S231G probably benign Het
Mup8 G A 4: 60,221,062 T101M probably benign Het
Myh8 T C 11: 67,288,353 I524T probably damaging Het
Pappa2 A G 1: 158,761,619 C1679R probably damaging Het
Pcdhb1 T C 18: 37,266,363 S456P possibly damaging Het
Pcdhga5 A G 18: 37,695,666 N389S probably benign Het
Pitrm1 C A 13: 6,567,471 S620R probably benign Het
Plod3 T A 5: 136,995,078 probably benign Het
Por A T 5: 135,730,917 Q194L probably benign Het
Prkag3 A T 1: 74,741,487 Y396N probably damaging Het
R3hcc1 T C 14: 69,697,604 probably null Het
Rcan3 C T 4: 135,425,281 S43N probably damaging Het
Rhot1 A G 11: 80,220,272 T31A probably damaging Het
Rnps1 T G 17: 24,418,512 S43A unknown Het
Rp1 T C 1: 4,346,203 D1562G possibly damaging Het
Rps19-ps13 A G 18: 40,726,375 noncoding transcript Het
Serpina3c A T 12: 104,149,512 S258T possibly damaging Het
Smc2 G A 4: 52,460,181 R519Q possibly damaging Het
Sorbs2 A T 8: 45,795,730 T593S probably benign Het
Sptbn2 A G 19: 4,737,857 T955A probably benign Het
Stfa3 T C 16: 36,452,219 K40E probably damaging Het
Tmem87b A G 2: 128,824,458 E75G probably benign Het
Tmprss15 T C 16: 79,003,410 Q595R probably benign Het
Trak1 A T 9: 121,460,412 I597F probably damaging Het
Trat1 T C 16: 48,734,937 D144G probably damaging Het
Trim25 T C 11: 88,999,532 V15A probably benign Het
Tulp1 A C 17: 28,359,060 probably null Het
Txndc15 T A 13: 55,717,921 M66K probably benign Het
Uhrf1bp1 A G 17: 27,881,556 H323R probably damaging Het
Vmn1r206 T A 13: 22,620,605 N144I probably damaging Het
Wwc2 T C 8: 47,900,761 T113A probably benign Het
Xpo5 A C 17: 46,217,609 E313D probably damaging Het
Zfp790 C T 7: 29,829,767 H626Y probably benign Het
Other mutations in Col5a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Col5a2 APN 1 45392877 splice site probably benign
IGL00978:Col5a2 APN 1 45376739 missense probably benign 0.01
IGL01366:Col5a2 APN 1 45391888 missense possibly damaging 0.46
IGL01487:Col5a2 APN 1 45376739 missense probably benign 0.01
IGL01820:Col5a2 APN 1 45442825 missense unknown
IGL01980:Col5a2 APN 1 45382233 splice site probably benign
IGL02063:Col5a2 APN 1 45403419 critical splice donor site probably null
IGL02134:Col5a2 APN 1 45391070 splice site probably null
IGL02233:Col5a2 APN 1 45383587 splice site probably null
IGL02489:Col5a2 APN 1 45392811 splice site probably null
IGL02928:Col5a2 APN 1 45385020 missense probably benign 0.41
IGL02931:Col5a2 APN 1 45385065 missense probably damaging 1.00
IGL03328:Col5a2 APN 1 45376146 missense possibly damaging 0.94
R0022:Col5a2 UTSW 1 45383683 nonsense probably null
R0123:Col5a2 UTSW 1 45407035 missense probably benign 0.28
R0180:Col5a2 UTSW 1 45411460 missense probably damaging 1.00
R0225:Col5a2 UTSW 1 45407035 missense probably benign 0.28
R0455:Col5a2 UTSW 1 45382102 splice site probably benign
R0485:Col5a2 UTSW 1 45378482 missense probably damaging 0.99
R0702:Col5a2 UTSW 1 45380131 missense possibly damaging 0.54
R0745:Col5a2 UTSW 1 45407227 splice site probably null
R1147:Col5a2 UTSW 1 45376771 missense probably damaging 0.99
R1147:Col5a2 UTSW 1 45376771 missense probably damaging 0.99
R1394:Col5a2 UTSW 1 45403419 critical splice donor site probably null
R1494:Col5a2 UTSW 1 45502914 start codon destroyed unknown
R1499:Col5a2 UTSW 1 45411466 missense probably benign 0.00
R1733:Col5a2 UTSW 1 45407032 missense possibly damaging 0.81
R1789:Col5a2 UTSW 1 45378305 critical splice donor site probably null
R1789:Col5a2 UTSW 1 45394776 missense probably damaging 0.98
R2114:Col5a2 UTSW 1 45376804 missense probably damaging 0.98
R2915:Col5a2 UTSW 1 45413496 missense probably damaging 1.00
R3861:Col5a2 UTSW 1 45380237 missense probably damaging 0.98
R4015:Col5a2 UTSW 1 45403471 missense probably benign 0.14
R4944:Col5a2 UTSW 1 45376695 missense possibly damaging 0.75
R4982:Col5a2 UTSW 1 45389458 missense possibly damaging 0.88
R5001:Col5a2 UTSW 1 45502898 missense unknown
R5197:Col5a2 UTSW 1 45393081 missense probably benign 0.01
R5407:Col5a2 UTSW 1 45406280 missense possibly damaging 0.54
R5502:Col5a2 UTSW 1 45380126 missense probably damaging 1.00
R5575:Col5a2 UTSW 1 45378482 missense probably damaging 0.99
R5622:Col5a2 UTSW 1 45427059 missense probably benign
R5643:Col5a2 UTSW 1 45390042 missense probably damaging 1.00
R5801:Col5a2 UTSW 1 45389481 critical splice acceptor site probably null
R6075:Col5a2 UTSW 1 45502848 missense unknown
R6211:Col5a2 UTSW 1 45376666 missense probably damaging 0.99
R6407:Col5a2 UTSW 1 45376778 missense probably damaging 0.99
R6494:Col5a2 UTSW 1 45378327 missense probably damaging 0.99
R6582:Col5a2 UTSW 1 45390115 missense possibly damaging 0.91
R6687:Col5a2 UTSW 1 45383604 missense probably damaging 1.00
R7007:Col5a2 UTSW 1 45378449 missense possibly damaging 0.53
R7062:Col5a2 UTSW 1 45417625 missense probably benign 0.00
R7098:Col5a2 UTSW 1 45380067 missense possibly damaging 0.48
R7243:Col5a2 UTSW 1 45376160 missense probably benign 0.39
X0013:Col5a2 UTSW 1 45403258 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAAGGCTTCTATGTTACACCAAAT -3'
(R):5'- AAAGAGATTGGAGTGTTGACTGTTA -3'

Sequencing Primer
(F):5'- TCATACTTTGTCATGCATTCAGAC -3'
(R):5'- TTTCTGGTCAACTGGCTG -3'
Posted On2016-06-21