Incidental Mutation 'R5159:Cblc'
ID396873
Institutional Source Beutler Lab
Gene Symbol Cblc
Ensembl Gene ENSMUSG00000040525
Gene NameCasitas B-lineage lymphoma c
Synonyms2310076I21Rik, Cbl3, 2310079L19Rik
MMRRC Submission 042741-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5159 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19778881-19796809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19785308 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 409 (E409G)
Ref Sequence ENSEMBL: ENSMUSP00000039955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043822] [ENSMUST00000108449]
Predicted Effect probably benign
Transcript: ENSMUST00000043822
AA Change: E409G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000039955
Gene: ENSMUSG00000040525
AA Change: E409G

DomainStartEndE-ValueType
Pfam:Cbl_N 13 144 2.6e-44 PFAM
Pfam:Cbl_N2 148 231 1.8e-35 PFAM
SH2 234 347 4.35e0 SMART
RING 350 388 1.92e-6 SMART
low complexity region 458 473 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108449
AA Change: E365G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000104088
Gene: ENSMUSG00000040525
AA Change: E365G

DomainStartEndE-ValueType
Pfam:Cbl_N 11 145 7.1e-20 PFAM
Pfam:Cbl_N2 147 231 2.3e-48 PFAM
SH2 234 333 5.28e0 SMART
low complexity region 414 429 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148416
Meta Mutation Damage Score 0.1256 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Cbl family of E3 ubiquitin ligases. Cbl proteins play important roles in cell signaling through the ubiquitination and subsequent downregulation of tyrosine kinases. Expression of this gene may be restricted to epithelial cells, and alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no abnormalities of the epithelium or other tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,153,308 M1340K probably benign Het
9930111J21Rik1 T C 11: 48,948,525 T412A probably benign Het
Aldh5a1 T A 13: 24,913,793 M420L possibly damaging Het
Armc2 A G 10: 42,008,715 S77P probably damaging Het
Avil A G 10: 127,020,448 probably null Het
Bmp5 T A 9: 75,893,753 F388L probably damaging Het
Brca2 T G 5: 150,542,108 V1779G possibly damaging Het
Cblb T A 16: 52,112,120 S147T probably damaging Het
Cdc34b C T 11: 94,742,060 R29W probably damaging Het
Clic6 T A 16: 92,528,066 Y371N probably benign Het
Col5a2 A G 1: 45,386,831 probably null Het
Coro1a A T 7: 126,703,049 V42D probably damaging Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Crb1 A C 1: 139,243,018 V817G probably damaging Het
Cyp2c39 A G 19: 39,560,934 T299A possibly damaging Het
Dock5 G A 14: 67,792,289 R1019C probably benign Het
Exoc8 T C 8: 124,896,213 T472A probably benign Het
Fancc A G 13: 63,321,865 probably null Het
Inpp5d T C 1: 87,676,342 L244P probably damaging Het
Ireb2 A G 9: 54,892,547 N424S probably benign Het
Krt35 T C 11: 100,094,049 D261G probably damaging Het
Lipc T A 9: 70,812,910 I272L probably benign Het
Lpcat3 A G 6: 124,699,394 probably benign Het
Lzts1 T C 8: 69,138,584 D304G probably benign Het
Mdn1 A G 4: 32,774,008 I5540V possibly damaging Het
Msln T C 17: 25,751,589 S231G probably benign Het
Mup8 G A 4: 60,221,062 T101M probably benign Het
Myh8 T C 11: 67,288,353 I524T probably damaging Het
Pappa2 A G 1: 158,761,619 C1679R probably damaging Het
Pcdhb1 T C 18: 37,266,363 S456P possibly damaging Het
Pcdhga5 A G 18: 37,695,666 N389S probably benign Het
Pitrm1 C A 13: 6,567,471 S620R probably benign Het
Plod3 T A 5: 136,995,078 probably benign Het
Por A T 5: 135,730,917 Q194L probably benign Het
Prkag3 A T 1: 74,741,487 Y396N probably damaging Het
R3hcc1 T C 14: 69,697,604 probably null Het
Rcan3 C T 4: 135,425,281 S43N probably damaging Het
Rhot1 A G 11: 80,220,272 T31A probably damaging Het
Rnps1 T G 17: 24,418,512 S43A unknown Het
Rp1 T C 1: 4,346,203 D1562G possibly damaging Het
Rps19-ps13 A G 18: 40,726,375 noncoding transcript Het
Serpina3c A T 12: 104,149,512 S258T possibly damaging Het
Smc2 G A 4: 52,460,181 R519Q possibly damaging Het
Sorbs2 A T 8: 45,795,730 T593S probably benign Het
Sptbn2 A G 19: 4,737,857 T955A probably benign Het
Stfa3 T C 16: 36,452,219 K40E probably damaging Het
Tmem87b A G 2: 128,824,458 E75G probably benign Het
Tmprss15 T C 16: 79,003,410 Q595R probably benign Het
Trak1 A T 9: 121,460,412 I597F probably damaging Het
Trat1 T C 16: 48,734,937 D144G probably damaging Het
Trim25 T C 11: 88,999,532 V15A probably benign Het
Tulp1 A C 17: 28,359,060 probably null Het
Txndc15 T A 13: 55,717,921 M66K probably benign Het
Uhrf1bp1 A G 17: 27,881,556 H323R probably damaging Het
Vmn1r206 T A 13: 22,620,605 N144I probably damaging Het
Wwc2 T C 8: 47,900,761 T113A probably benign Het
Xpo5 A C 17: 46,217,609 E313D probably damaging Het
Zfp790 C T 7: 29,829,767 H626Y probably benign Het
Other mutations in Cblc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Cblc APN 7 19785275 missense probably benign 0.00
R0583:Cblc UTSW 7 19792561 missense probably benign 0.41
R0847:Cblc UTSW 7 19790534 nonsense probably null
R1594:Cblc UTSW 7 19792546 missense probably damaging 1.00
R1626:Cblc UTSW 7 19796502 missense probably damaging 1.00
R1719:Cblc UTSW 7 19790474 missense probably benign 0.00
R1894:Cblc UTSW 7 19792577 missense probably damaging 0.99
R2011:Cblc UTSW 7 19784822 missense probably benign 0.01
R2395:Cblc UTSW 7 19785380 missense probably damaging 1.00
R2852:Cblc UTSW 7 19780964 splice site probably null
R3832:Cblc UTSW 7 19792172 missense probably damaging 0.98
R4696:Cblc UTSW 7 19796482 missense probably damaging 1.00
R5328:Cblc UTSW 7 19792580 missense possibly damaging 0.68
R5487:Cblc UTSW 7 19784808 missense probably benign 0.06
R5659:Cblc UTSW 7 19792932 missense probably damaging 1.00
R6209:Cblc UTSW 7 19785305 missense possibly damaging 0.47
R6519:Cblc UTSW 7 19792863 missense probably damaging 1.00
R6841:Cblc UTSW 7 19792896 missense probably damaging 1.00
X0028:Cblc UTSW 7 19785273 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGATGTATTGAGTCTAGCCTCC -3'
(R):5'- CCTGGATTCAGAGTATACCAGCC -3'

Sequencing Primer
(F):5'- CTCCCTCAGATCCAGGACTTCAG -3'
(R):5'- TGGATTCAGAGTATACCAGCCACATC -3'
Posted On2016-06-21