Incidental Mutation 'R5159:Myh8'
ID396887
Institutional Source Beutler Lab
Gene Symbol Myh8
Ensembl Gene ENSMUSG00000055775
Gene Namemyosin, heavy polypeptide 8, skeletal muscle, perinatal
SynonymsMyhsp, 4832426G23Rik, MyHC-pn, Myhs-p
MMRRC Submission 042741-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.749) question?
Stock #R5159 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67277124-67308634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67288353 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 524 (I524T)
Ref Sequence ENSEMBL: ENSMUSP00000019625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019625]
Predicted Effect probably damaging
Transcript: ENSMUST00000019625
AA Change: I524T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000019625
Gene: ENSMUSG00000055775
AA Change: I524T

DomainStartEndE-ValueType
Pfam:Myosin_N 37 76 2.1e-13 PFAM
MYSc 82 782 N/A SMART
IQ 783 805 5.44e-3 SMART
Pfam:Myosin_tail_1 846 1927 2.4e-164 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139052
Meta Mutation Damage Score 0.282 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer with two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. This gene is located in a cluster of related genes on chromosome 11. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,153,308 M1340K probably benign Het
9930111J21Rik1 T C 11: 48,948,525 T412A probably benign Het
Aldh5a1 T A 13: 24,913,793 M420L possibly damaging Het
Armc2 A G 10: 42,008,715 S77P probably damaging Het
Avil A G 10: 127,020,448 probably null Het
Bmp5 T A 9: 75,893,753 F388L probably damaging Het
Brca2 T G 5: 150,542,108 V1779G possibly damaging Het
Cblb T A 16: 52,112,120 S147T probably damaging Het
Cblc T C 7: 19,785,308 E409G probably benign Het
Cdc34b C T 11: 94,742,060 R29W probably damaging Het
Clic6 T A 16: 92,528,066 Y371N probably benign Het
Col5a2 A G 1: 45,386,831 probably null Het
Coro1a A T 7: 126,703,049 V42D probably damaging Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Crb1 A C 1: 139,243,018 V817G probably damaging Het
Cyp2c39 A G 19: 39,560,934 T299A possibly damaging Het
Dock5 G A 14: 67,792,289 R1019C probably benign Het
Exoc8 T C 8: 124,896,213 T472A probably benign Het
Fancc A G 13: 63,321,865 probably null Het
Inpp5d T C 1: 87,676,342 L244P probably damaging Het
Ireb2 A G 9: 54,892,547 N424S probably benign Het
Krt35 T C 11: 100,094,049 D261G probably damaging Het
Lipc T A 9: 70,812,910 I272L probably benign Het
Lpcat3 A G 6: 124,699,394 probably benign Het
Lzts1 T C 8: 69,138,584 D304G probably benign Het
Mdn1 A G 4: 32,774,008 I5540V possibly damaging Het
Msln T C 17: 25,751,589 S231G probably benign Het
Mup8 G A 4: 60,221,062 T101M probably benign Het
Pappa2 A G 1: 158,761,619 C1679R probably damaging Het
Pcdhb1 T C 18: 37,266,363 S456P possibly damaging Het
Pcdhga5 A G 18: 37,695,666 N389S probably benign Het
Pitrm1 C A 13: 6,567,471 S620R probably benign Het
Plod3 T A 5: 136,995,078 probably benign Het
Por A T 5: 135,730,917 Q194L probably benign Het
Prkag3 A T 1: 74,741,487 Y396N probably damaging Het
R3hcc1 T C 14: 69,697,604 probably null Het
Rcan3 C T 4: 135,425,281 S43N probably damaging Het
Rhot1 A G 11: 80,220,272 T31A probably damaging Het
Rnps1 T G 17: 24,418,512 S43A unknown Het
Rp1 T C 1: 4,346,203 D1562G possibly damaging Het
Rps19-ps13 A G 18: 40,726,375 noncoding transcript Het
Serpina3c A T 12: 104,149,512 S258T possibly damaging Het
Smc2 G A 4: 52,460,181 R519Q possibly damaging Het
Sorbs2 A T 8: 45,795,730 T593S probably benign Het
Sptbn2 A G 19: 4,737,857 T955A probably benign Het
Stfa3 T C 16: 36,452,219 K40E probably damaging Het
Tmem87b A G 2: 128,824,458 E75G probably benign Het
Tmprss15 T C 16: 79,003,410 Q595R probably benign Het
Trak1 A T 9: 121,460,412 I597F probably damaging Het
Trat1 T C 16: 48,734,937 D144G probably damaging Het
Trim25 T C 11: 88,999,532 V15A probably benign Het
Tulp1 A C 17: 28,359,060 probably null Het
Txndc15 T A 13: 55,717,921 M66K probably benign Het
Uhrf1bp1 A G 17: 27,881,556 H323R probably damaging Het
Vmn1r206 T A 13: 22,620,605 N144I probably damaging Het
Wwc2 T C 8: 47,900,761 T113A probably benign Het
Xpo5 A C 17: 46,217,609 E313D probably damaging Het
Zfp790 C T 7: 29,829,767 H626Y probably benign Het
Other mutations in Myh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL01020:Myh8 APN 11 67283403 missense probably damaging 0.99
IGL01348:Myh8 APN 11 67297780 missense probably damaging 1.00
IGL01382:Myh8 APN 11 67301973 missense probably damaging 1.00
IGL01454:Myh8 APN 11 67283596 missense probably damaging 1.00
IGL01457:Myh8 APN 11 67292679 missense probably benign 0.00
IGL01472:Myh8 APN 11 67288379 splice site probably benign
IGL01473:Myh8 APN 11 67301825 critical splice donor site probably null
IGL01613:Myh8 APN 11 67301710 missense probably benign 0.11
IGL01763:Myh8 APN 11 67286419 missense probably benign 0.01
IGL01828:Myh8 APN 11 67303826 missense possibly damaging 0.82
IGL01862:Myh8 APN 11 67289694 nonsense probably null
IGL01905:Myh8 APN 11 67284651 missense possibly damaging 0.90
IGL02280:Myh8 APN 11 67283372 unclassified probably benign
IGL02386:Myh8 APN 11 67294440 missense probably damaging 0.99
IGL02449:Myh8 APN 11 67294614 critical splice donor site probably null
IGL02500:Myh8 APN 11 67305710 missense probably benign 0.00
IGL02745:Myh8 APN 11 67297501 missense possibly damaging 0.88
IGL02799:Myh8 APN 11 67301592 splice site probably benign
IGL03063:Myh8 APN 11 67288205 missense probably benign 0.00
IGL03223:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL03336:Myh8 APN 11 67284702 missense probably damaging 1.00
IGL03338:Myh8 APN 11 67298346 missense probably damaging 1.00
IGL03351:Myh8 APN 11 67303913 missense possibly damaging 0.94
IGL03392:Myh8 APN 11 67294418 missense probably damaging 1.00
PIT4354001:Myh8 UTSW 11 67289630 missense probably benign 0.01
R0012:Myh8 UTSW 11 67300021 missense probably benign 0.02
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0115:Myh8 UTSW 11 67306264 splice site probably benign
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0132:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0393:Myh8 UTSW 11 67306017 splice site probably benign
R0453:Myh8 UTSW 11 67292905 missense probably benign 0.03
R0454:Myh8 UTSW 11 67303765 nonsense probably null
R0466:Myh8 UTSW 11 67298579 missense probably benign 0.01
R0487:Myh8 UTSW 11 67302011 missense probably benign
R0511:Myh8 UTSW 11 67284507 missense probably benign 0.01
R0557:Myh8 UTSW 11 67301798 missense possibly damaging 0.88
R0589:Myh8 UTSW 11 67298627 missense probably benign 0.00
R0658:Myh8 UTSW 11 67284532 critical splice donor site probably null
R0782:Myh8 UTSW 11 67289754 missense probably benign 0.16
R0829:Myh8 UTSW 11 67283500 unclassified probably benign
R0845:Myh8 UTSW 11 67286264 missense probably damaging 1.00
R0930:Myh8 UTSW 11 67305998 missense possibly damaging 0.93
R0972:Myh8 UTSW 11 67297759 missense probably damaging 1.00
R1132:Myh8 UTSW 11 67297131 nonsense probably null
R1417:Myh8 UTSW 11 67306185 missense probably damaging 1.00
R1478:Myh8 UTSW 11 67292725 missense probably benign 0.23
R1497:Myh8 UTSW 11 67289812 missense probably benign 0.00
R1605:Myh8 UTSW 11 67301671 missense probably damaging 0.99
R1701:Myh8 UTSW 11 67280138 missense probably damaging 1.00
R1950:Myh8 UTSW 11 67279004 missense possibly damaging 0.75
R1989:Myh8 UTSW 11 67292724 missense probably benign 0.00
R2010:Myh8 UTSW 11 67297164 nonsense probably null
R2095:Myh8 UTSW 11 67286224 missense probably benign 0.00
R2132:Myh8 UTSW 11 67292876 missense probably damaging 1.00
R2152:Myh8 UTSW 11 67294469 missense probably damaging 0.97
R2229:Myh8 UTSW 11 67308348 missense probably damaging 0.98
R2302:Myh8 UTSW 11 67286239 missense probably damaging 1.00
R2364:Myh8 UTSW 11 67294518 missense probably benign 0.03
R2429:Myh8 UTSW 11 67303897 missense probably benign 0.21
R2880:Myh8 UTSW 11 67297264 missense probably damaging 0.97
R3692:Myh8 UTSW 11 67301918 missense probably damaging 0.98
R3756:Myh8 UTSW 11 67284617 unclassified probably benign
R3924:Myh8 UTSW 11 67297137 missense probably damaging 0.99
R4172:Myh8 UTSW 11 67292421 missense probably damaging 1.00
R4255:Myh8 UTSW 11 67299734 missense probably benign
R4621:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4623:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4790:Myh8 UTSW 11 67279963 missense probably damaging 0.99
R4914:Myh8 UTSW 11 67292684 missense probably damaging 1.00
R5074:Myh8 UTSW 11 67305916 missense possibly damaging 0.79
R5119:Myh8 UTSW 11 67298358 missense probably damaging 1.00
R5229:Myh8 UTSW 11 67284484 missense probably damaging 0.96
R5320:Myh8 UTSW 11 67286263 missense probably damaging 1.00
R5455:Myh8 UTSW 11 67301418 missense possibly damaging 0.59
R5523:Myh8 UTSW 11 67305962 missense possibly damaging 0.95
R5540:Myh8 UTSW 11 67286440 missense probably benign 0.00
R5726:Myh8 UTSW 11 67294566 missense possibly damaging 0.79
R5770:Myh8 UTSW 11 67297200 missense probably damaging 1.00
R6135:Myh8 UTSW 11 67297500 missense possibly damaging 0.51
R6253:Myh8 UTSW 11 67301967 missense probably benign 0.06
R6318:Myh8 UTSW 11 67299341 missense probably benign 0.00
R6432:Myh8 UTSW 11 67298579 missense probably benign 0.01
R6452:Myh8 UTSW 11 67292449 missense probably benign 0.27
R6452:Myh8 UTSW 11 67305739 missense possibly damaging 0.88
R6512:Myh8 UTSW 11 67289662 nonsense probably null
R6714:Myh8 UTSW 11 67306949 missense probably damaging 1.00
R6842:Myh8 UTSW 11 67284655 missense probably damaging 1.00
R7007:Myh8 UTSW 11 67288316 missense probably benign 0.03
R7025:Myh8 UTSW 11 67297539 missense probably benign 0.02
R7086:Myh8 UTSW 11 67292627 splice site probably null
R7098:Myh8 UTSW 11 67279053 missense probably benign 0.03
T0722:Myh8 UTSW 11 67304436 missense probably benign 0.41
Z1088:Myh8 UTSW 11 67298592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGGAAATCTCTACTGCTCTG -3'
(R):5'- GCGGAGTATTCACAACTGCC -3'

Sequencing Primer
(F):5'- GGAAATCTCTACTGCTCTGTTGTAG -3'
(R):5'- CTGCCTTTAAACTGGATATGAGTCAG -3'
Posted On2016-06-21