Incidental Mutation 'R5159:Pitrm1'
ID396893
Institutional Source Beutler Lab
Gene Symbol Pitrm1
Ensembl Gene ENSMUSG00000021193
Gene Namepitrilysin metallepetidase 1
SynonymsNtup1, PreP, 2310012C15Rik, MP-1
MMRRC Submission 042741-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R5159 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location6548149-6580515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 6567471 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 620 (S620R)
Ref Sequence ENSEMBL: ENSMUSP00000152229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021611] [ENSMUST00000222485]
Predicted Effect probably benign
Transcript: ENSMUST00000021611
AA Change: S581R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021611
Gene: ENSMUSG00000021193
AA Change: S581R

DomainStartEndE-ValueType
Pfam:Peptidase_M16 93 188 1.8e-7 PFAM
Pfam:Peptidase_M16_C 244 431 4.7e-27 PFAM
M16C_associated 504 752 2.8e-114 SMART
Pfam:Peptidase_M16_C 771 958 2.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222485
AA Change: S620R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223492
Meta Mutation Damage Score 0.234 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ATP-dependent metalloprotease that degrades post-cleavage mitochondrial transit peptides. The encoded protein binds zinc and can also degrade amyloid beta A4 protein, suggesting a possible role in Alzheimer's disease. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null mice show complete preweaning lethality. Heterozygotes show progressive ataxia, neurodegeneration, and accumulation of amyloid beta deposits. Mitochondria show impaired degradation rate of amyloid beta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,153,308 M1340K probably benign Het
9930111J21Rik1 T C 11: 48,948,525 T412A probably benign Het
Aldh5a1 T A 13: 24,913,793 M420L possibly damaging Het
Armc2 A G 10: 42,008,715 S77P probably damaging Het
Avil A G 10: 127,020,448 probably null Het
Bmp5 T A 9: 75,893,753 F388L probably damaging Het
Brca2 T G 5: 150,542,108 V1779G possibly damaging Het
Cblb T A 16: 52,112,120 S147T probably damaging Het
Cblc T C 7: 19,785,308 E409G probably benign Het
Cdc34b C T 11: 94,742,060 R29W probably damaging Het
Clic6 T A 16: 92,528,066 Y371N probably benign Het
Col5a2 A G 1: 45,386,831 probably null Het
Coro1a A T 7: 126,703,049 V42D probably damaging Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Crb1 A C 1: 139,243,018 V817G probably damaging Het
Cyp2c39 A G 19: 39,560,934 T299A possibly damaging Het
Dock5 G A 14: 67,792,289 R1019C probably benign Het
Exoc8 T C 8: 124,896,213 T472A probably benign Het
Fancc A G 13: 63,321,865 probably null Het
Inpp5d T C 1: 87,676,342 L244P probably damaging Het
Ireb2 A G 9: 54,892,547 N424S probably benign Het
Krt35 T C 11: 100,094,049 D261G probably damaging Het
Lipc T A 9: 70,812,910 I272L probably benign Het
Lpcat3 A G 6: 124,699,394 probably benign Het
Lzts1 T C 8: 69,138,584 D304G probably benign Het
Mdn1 A G 4: 32,774,008 I5540V possibly damaging Het
Msln T C 17: 25,751,589 S231G probably benign Het
Mup8 G A 4: 60,221,062 T101M probably benign Het
Myh8 T C 11: 67,288,353 I524T probably damaging Het
Pappa2 A G 1: 158,761,619 C1679R probably damaging Het
Pcdhb1 T C 18: 37,266,363 S456P possibly damaging Het
Pcdhga5 A G 18: 37,695,666 N389S probably benign Het
Plod3 T A 5: 136,995,078 probably benign Het
Por A T 5: 135,730,917 Q194L probably benign Het
Prkag3 A T 1: 74,741,487 Y396N probably damaging Het
R3hcc1 T C 14: 69,697,604 probably null Het
Rcan3 C T 4: 135,425,281 S43N probably damaging Het
Rhot1 A G 11: 80,220,272 T31A probably damaging Het
Rnps1 T G 17: 24,418,512 S43A unknown Het
Rp1 T C 1: 4,346,203 D1562G possibly damaging Het
Rps19-ps13 A G 18: 40,726,375 noncoding transcript Het
Serpina3c A T 12: 104,149,512 S258T possibly damaging Het
Smc2 G A 4: 52,460,181 R519Q possibly damaging Het
Sorbs2 A T 8: 45,795,730 T593S probably benign Het
Sptbn2 A G 19: 4,737,857 T955A probably benign Het
Stfa3 T C 16: 36,452,219 K40E probably damaging Het
Tmem87b A G 2: 128,824,458 E75G probably benign Het
Tmprss15 T C 16: 79,003,410 Q595R probably benign Het
Trak1 A T 9: 121,460,412 I597F probably damaging Het
Trat1 T C 16: 48,734,937 D144G probably damaging Het
Trim25 T C 11: 88,999,532 V15A probably benign Het
Tulp1 A C 17: 28,359,060 probably null Het
Txndc15 T A 13: 55,717,921 M66K probably benign Het
Uhrf1bp1 A G 17: 27,881,556 H323R probably damaging Het
Vmn1r206 T A 13: 22,620,605 N144I probably damaging Het
Wwc2 T C 8: 47,900,761 T113A probably benign Het
Xpo5 A C 17: 46,217,609 E313D probably damaging Het
Zfp790 C T 7: 29,829,767 H626Y probably benign Het
Other mutations in Pitrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Pitrm1 APN 13 6568666 missense probably damaging 1.00
IGL01148:Pitrm1 APN 13 6573105 missense probably benign
IGL01408:Pitrm1 APN 13 6573042 missense probably damaging 1.00
IGL01557:Pitrm1 APN 13 6552684 missense probably benign 0.37
IGL01803:Pitrm1 APN 13 6579435 missense probably benign 0.00
IGL02111:Pitrm1 APN 13 6573145 missense probably benign 0.45
IGL02217:Pitrm1 APN 13 6567341 splice site probably benign
IGL02539:Pitrm1 APN 13 6568756 missense probably benign 0.26
IGL02935:Pitrm1 APN 13 6553264 missense probably damaging 1.00
IGL03028:Pitrm1 APN 13 6574393 missense probably benign 0.00
IGL03112:Pitrm1 APN 13 6565008 missense probably benign 0.10
FR4737:Pitrm1 UTSW 13 6560596 critical splice acceptor site probably benign
FR4976:Pitrm1 UTSW 13 6560596 critical splice acceptor site probably benign
R0078:Pitrm1 UTSW 13 6575032 missense probably damaging 0.99
R0085:Pitrm1 UTSW 13 6549568 splice site probably benign
R0089:Pitrm1 UTSW 13 6555639 missense probably damaging 1.00
R0234:Pitrm1 UTSW 13 6575079 nonsense probably null
R0234:Pitrm1 UTSW 13 6575079 nonsense probably null
R0478:Pitrm1 UTSW 13 6559395 missense probably damaging 0.99
R0496:Pitrm1 UTSW 13 6568714 missense probably damaging 1.00
R0781:Pitrm1 UTSW 13 6558244 missense probably benign 0.03
R1061:Pitrm1 UTSW 13 6555575 missense probably damaging 0.99
R1110:Pitrm1 UTSW 13 6558244 missense probably benign 0.03
R1170:Pitrm1 UTSW 13 6552744 splice site probably benign
R1373:Pitrm1 UTSW 13 6570700 missense probably benign 0.03
R1563:Pitrm1 UTSW 13 6563470 missense possibly damaging 0.85
R1897:Pitrm1 UTSW 13 6560095 missense possibly damaging 0.78
R1985:Pitrm1 UTSW 13 6558184 missense probably damaging 1.00
R2075:Pitrm1 UTSW 13 6555383 missense probably damaging 1.00
R2114:Pitrm1 UTSW 13 6557773 missense probably damaging 1.00
R2115:Pitrm1 UTSW 13 6557773 missense probably damaging 1.00
R2206:Pitrm1 UTSW 13 6569291 missense probably damaging 1.00
R2207:Pitrm1 UTSW 13 6569291 missense probably damaging 1.00
R2260:Pitrm1 UTSW 13 6560125 missense probably damaging 1.00
R2568:Pitrm1 UTSW 13 6575092 missense probably benign 0.15
R3409:Pitrm1 UTSW 13 6578481 missense possibly damaging 0.81
R3756:Pitrm1 UTSW 13 6558235 missense probably damaging 1.00
R4020:Pitrm1 UTSW 13 6556687 missense probably damaging 1.00
R4327:Pitrm1 UTSW 13 6579773 utr 3 prime probably benign
R4540:Pitrm1 UTSW 13 6555470 critical splice donor site probably null
R4579:Pitrm1 UTSW 13 6558225 missense probably benign 0.05
R4659:Pitrm1 UTSW 13 6553182 missense probably benign 0.37
R4685:Pitrm1 UTSW 13 6556542 missense probably benign 0.00
R4888:Pitrm1 UTSW 13 6578560 missense probably damaging 1.00
R5072:Pitrm1 UTSW 13 6553190 missense probably damaging 1.00
R5383:Pitrm1 UTSW 13 6577432 missense probably damaging 1.00
R5470:Pitrm1 UTSW 13 6553270 missense probably benign 0.07
R5606:Pitrm1 UTSW 13 6560065 missense probably damaging 1.00
R6224:Pitrm1 UTSW 13 6565054 missense probably damaging 1.00
R6302:Pitrm1 UTSW 13 6560061 missense probably damaging 0.99
R6898:Pitrm1 UTSW 13 6555459 missense probably damaging 1.00
R7021:Pitrm1 UTSW 13 6578557 missense probably damaging 0.99
R7249:Pitrm1 UTSW 13 6560125 missense probably damaging 1.00
R7256:Pitrm1 UTSW 13 6556597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTGGTACATGAGACCTG -3'
(R):5'- GAGAGTAGCTTGTGCACACTG -3'

Sequencing Primer
(F):5'- GCCTTGGTACATGAGACCTGATTTC -3'
(R):5'- GTAGCTTGTGCACACTGTGACAAC -3'
Posted On2016-06-21