Incidental Mutation 'R5159:Msln'
ID396906
Institutional Source Beutler Lab
Gene Symbol Msln
Ensembl Gene ENSMUSG00000063011
Gene Namemesothelin
SynonymsMPF, megakaryocyte potentiating factor
MMRRC Submission 042741-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R5159 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25748614-25754327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25751589 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 231 (S231G)
Ref Sequence ENSEMBL: ENSMUSP00000075279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098] [ENSMUST00000075884]
Predicted Effect probably benign
Transcript: ENSMUST00000047098
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075884
AA Change: S231G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000075279
Gene: ENSMUSG00000063011
AA Change: S231G

DomainStartEndE-ValueType
Pfam:Mesothelin 1 624 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102319
Meta Mutation Damage Score 0.1232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a preproprotein that is proteolytically processed to generate two protein products, megakaryocyte potentiating factor and mesothelin. Megakaryocyte potentiating factor functions as a cytokine that can stimulate colony formation of bone marrow megakaryocytes. Mesothelin is a glycosylphosphatidylinositol-anchored cell-surface protein that may function as a cell adhesion protein. This protein is overexpressed in epithelial mesotheliomas, ovarian cancers and in specific squamous cell carcinomas. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for disruptions in this allele display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,153,308 M1340K probably benign Het
9930111J21Rik1 T C 11: 48,948,525 T412A probably benign Het
Aldh5a1 T A 13: 24,913,793 M420L possibly damaging Het
Armc2 A G 10: 42,008,715 S77P probably damaging Het
Avil A G 10: 127,020,448 probably null Het
Bmp5 T A 9: 75,893,753 F388L probably damaging Het
Brca2 T G 5: 150,542,108 V1779G possibly damaging Het
Cblb T A 16: 52,112,120 S147T probably damaging Het
Cblc T C 7: 19,785,308 E409G probably benign Het
Cdc34b C T 11: 94,742,060 R29W probably damaging Het
Clic6 T A 16: 92,528,066 Y371N probably benign Het
Col5a2 A G 1: 45,386,831 probably null Het
Coro1a A T 7: 126,703,049 V42D probably damaging Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Crb1 A C 1: 139,243,018 V817G probably damaging Het
Cyp2c39 A G 19: 39,560,934 T299A possibly damaging Het
Dock5 G A 14: 67,792,289 R1019C probably benign Het
Exoc8 T C 8: 124,896,213 T472A probably benign Het
Fancc A G 13: 63,321,865 probably null Het
Inpp5d T C 1: 87,676,342 L244P probably damaging Het
Ireb2 A G 9: 54,892,547 N424S probably benign Het
Krt35 T C 11: 100,094,049 D261G probably damaging Het
Lipc T A 9: 70,812,910 I272L probably benign Het
Lpcat3 A G 6: 124,699,394 probably benign Het
Lzts1 T C 8: 69,138,584 D304G probably benign Het
Mdn1 A G 4: 32,774,008 I5540V possibly damaging Het
Mup8 G A 4: 60,221,062 T101M probably benign Het
Myh8 T C 11: 67,288,353 I524T probably damaging Het
Pappa2 A G 1: 158,761,619 C1679R probably damaging Het
Pcdhb1 T C 18: 37,266,363 S456P possibly damaging Het
Pcdhga5 A G 18: 37,695,666 N389S probably benign Het
Pitrm1 C A 13: 6,567,471 S620R probably benign Het
Plod3 T A 5: 136,995,078 probably benign Het
Por A T 5: 135,730,917 Q194L probably benign Het
Prkag3 A T 1: 74,741,487 Y396N probably damaging Het
R3hcc1 T C 14: 69,697,604 probably null Het
Rcan3 C T 4: 135,425,281 S43N probably damaging Het
Rhot1 A G 11: 80,220,272 T31A probably damaging Het
Rnps1 T G 17: 24,418,512 S43A unknown Het
Rp1 T C 1: 4,346,203 D1562G possibly damaging Het
Rps19-ps13 A G 18: 40,726,375 noncoding transcript Het
Serpina3c A T 12: 104,149,512 S258T possibly damaging Het
Smc2 G A 4: 52,460,181 R519Q possibly damaging Het
Sorbs2 A T 8: 45,795,730 T593S probably benign Het
Sptbn2 A G 19: 4,737,857 T955A probably benign Het
Stfa3 T C 16: 36,452,219 K40E probably damaging Het
Tmem87b A G 2: 128,824,458 E75G probably benign Het
Tmprss15 T C 16: 79,003,410 Q595R probably benign Het
Trak1 A T 9: 121,460,412 I597F probably damaging Het
Trat1 T C 16: 48,734,937 D144G probably damaging Het
Trim25 T C 11: 88,999,532 V15A probably benign Het
Tulp1 A C 17: 28,359,060 probably null Het
Txndc15 T A 13: 55,717,921 M66K probably benign Het
Uhrf1bp1 A G 17: 27,881,556 H323R probably damaging Het
Vmn1r206 T A 13: 22,620,605 N144I probably damaging Het
Wwc2 T C 8: 47,900,761 T113A probably benign Het
Xpo5 A C 17: 46,217,609 E313D probably damaging Het
Zfp790 C T 7: 29,829,767 H626Y probably benign Het
Other mutations in Msln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Msln APN 17 25750030 critical splice donor site probably null
IGL02986:Msln APN 17 25752933 splice site probably benign
R0349:Msln UTSW 17 25750276 missense possibly damaging 0.69
R0562:Msln UTSW 17 25753006 missense probably benign 0.16
R0845:Msln UTSW 17 25750796 missense probably damaging 1.00
R1256:Msln UTSW 17 25754183 missense probably damaging 1.00
R1305:Msln UTSW 17 25753027 missense probably benign 0.00
R1651:Msln UTSW 17 25753408 missense probably benign 0.00
R1930:Msln UTSW 17 25751922 missense probably damaging 0.99
R1996:Msln UTSW 17 25754219 start codon destroyed possibly damaging 0.94
R4532:Msln UTSW 17 25750724 missense probably damaging 0.98
R5004:Msln UTSW 17 25754219 start codon destroyed possibly damaging 0.94
R5157:Msln UTSW 17 25752983 missense probably benign 0.01
R5510:Msln UTSW 17 25749873 missense probably benign 0.15
R6385:Msln UTSW 17 25751141 missense probably benign 0.19
R6650:Msln UTSW 17 25750170 missense probably benign 0.00
R6682:Msln UTSW 17 25753019 missense probably damaging 0.99
R7091:Msln UTSW 17 25750080 missense probably damaging 1.00
X0002:Msln UTSW 17 25752310 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TCAGAGACCAAGAATGTGACCC -3'
(R):5'- ACAGGGCGTGTATGGATTTC -3'

Sequencing Primer
(F):5'- ATGTGACCCCAGGTAGACATCG -3'
(R):5'- ATGGATTTCAAGTGAGTGAGGC -3'
Posted On2016-06-21