Incidental Mutation 'R5159:Rps19-ps13'
ID396911
Institutional Source Beutler Lab
Gene Symbol Rps19-ps13
Ensembl Gene ENSMUSG00000095150
Gene Nameribosomal protein S19, pseudogene 13
SynonymsGm4838
MMRRC Submission 042741-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R5159 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location40726269-40726709 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to G at 40726375 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180504
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,153,308 M1340K probably benign Het
9930111J21Rik1 T C 11: 48,948,525 T412A probably benign Het
Aldh5a1 T A 13: 24,913,793 M420L possibly damaging Het
Armc2 A G 10: 42,008,715 S77P probably damaging Het
Avil A G 10: 127,020,448 probably null Het
Bmp5 T A 9: 75,893,753 F388L probably damaging Het
Brca2 T G 5: 150,542,108 V1779G possibly damaging Het
Cblb T A 16: 52,112,120 S147T probably damaging Het
Cblc T C 7: 19,785,308 E409G probably benign Het
Cdc34b C T 11: 94,742,060 R29W probably damaging Het
Clic6 T A 16: 92,528,066 Y371N probably benign Het
Col5a2 A G 1: 45,386,831 probably null Het
Coro1a A T 7: 126,703,049 V42D probably damaging Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Crb1 A C 1: 139,243,018 V817G probably damaging Het
Cyp2c39 A G 19: 39,560,934 T299A possibly damaging Het
Dock5 G A 14: 67,792,289 R1019C probably benign Het
Exoc8 T C 8: 124,896,213 T472A probably benign Het
Fancc A G 13: 63,321,865 probably null Het
Inpp5d T C 1: 87,676,342 L244P probably damaging Het
Ireb2 A G 9: 54,892,547 N424S probably benign Het
Krt35 T C 11: 100,094,049 D261G probably damaging Het
Lipc T A 9: 70,812,910 I272L probably benign Het
Lpcat3 A G 6: 124,699,394 probably benign Het
Lzts1 T C 8: 69,138,584 D304G probably benign Het
Mdn1 A G 4: 32,774,008 I5540V possibly damaging Het
Msln T C 17: 25,751,589 S231G probably benign Het
Mup8 G A 4: 60,221,062 T101M probably benign Het
Myh8 T C 11: 67,288,353 I524T probably damaging Het
Pappa2 A G 1: 158,761,619 C1679R probably damaging Het
Pcdhb1 T C 18: 37,266,363 S456P possibly damaging Het
Pcdhga5 A G 18: 37,695,666 N389S probably benign Het
Pitrm1 C A 13: 6,567,471 S620R probably benign Het
Plod3 T A 5: 136,995,078 probably benign Het
Por A T 5: 135,730,917 Q194L probably benign Het
Prkag3 A T 1: 74,741,487 Y396N probably damaging Het
R3hcc1 T C 14: 69,697,604 probably null Het
Rcan3 C T 4: 135,425,281 S43N probably damaging Het
Rhot1 A G 11: 80,220,272 T31A probably damaging Het
Rnps1 T G 17: 24,418,512 S43A unknown Het
Rp1 T C 1: 4,346,203 D1562G possibly damaging Het
Serpina3c A T 12: 104,149,512 S258T possibly damaging Het
Smc2 G A 4: 52,460,181 R519Q possibly damaging Het
Sorbs2 A T 8: 45,795,730 T593S probably benign Het
Sptbn2 A G 19: 4,737,857 T955A probably benign Het
Stfa3 T C 16: 36,452,219 K40E probably damaging Het
Tmem87b A G 2: 128,824,458 E75G probably benign Het
Tmprss15 T C 16: 79,003,410 Q595R probably benign Het
Trak1 A T 9: 121,460,412 I597F probably damaging Het
Trat1 T C 16: 48,734,937 D144G probably damaging Het
Trim25 T C 11: 88,999,532 V15A probably benign Het
Tulp1 A C 17: 28,359,060 probably null Het
Txndc15 T A 13: 55,717,921 M66K probably benign Het
Uhrf1bp1 A G 17: 27,881,556 H323R probably damaging Het
Vmn1r206 T A 13: 22,620,605 N144I probably damaging Het
Wwc2 T C 8: 47,900,761 T113A probably benign Het
Xpo5 A C 17: 46,217,609 E313D probably damaging Het
Zfp790 C T 7: 29,829,767 H626Y probably benign Het
Other mutations in Rps19-ps13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02837:Rps19-ps13 UTSW 18 40726394 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGACAAATCCATGCTTTAATCACCC -3'
(R):5'- TGAAGAGTCTGGGCCTGTTAC -3'

Sequencing Primer
(F):5'- AATCACCCTCAGCCCTGTGG -3'
(R):5'- CTGGGCCTGTTACGGTTTCTC -3'
Posted On2016-06-21