Incidental Mutation 'R5160:Zc3h3'
ID396958
Institutional Source Beutler Lab
Gene Symbol Zc3h3
Ensembl Gene ENSMUSG00000075600
Gene Namezinc finger CCCH type containing 3
SynonymsSmicl
MMRRC Submission 042742-MU
Accession Numbers

Genbank: NM_172121.1; Ensembl: ENSMUST00000100538

Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R5160 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location75754430-75841915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75809663 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 523 (M523K)
Ref Sequence ENSEMBL: ENSMUSP00000098106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100538]
Predicted Effect probably benign
Transcript: ENSMUST00000100538
AA Change: M523K

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000098106
Gene: ENSMUSG00000075600
AA Change: M523K

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 370 388 N/A INTRINSIC
low complexity region 543 558 N/A INTRINSIC
ZnF_C3H1 663 689 1.03e-2 SMART
ZnF_C3H1 690 716 1.16e-1 SMART
ZnF_C3H1 718 743 5.38e-6 SMART
ZnF_C3H1 745 771 2.88e-6 SMART
ZnF_C3H1 772 794 1.64e-1 SMART
low complexity region 839 888 N/A INTRINSIC
low complexity region 895 905 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229970
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph G A 11: 20,712,197 P681L probably benign Het
Akap9 A G 5: 4,030,007 R1920G probably damaging Het
Ano9 G A 7: 141,104,365 R495C probably damaging Het
Apoa5 A G 9: 46,270,496 Y290C probably damaging Het
Apob T C 12: 8,012,126 I3536T possibly damaging Het
Arhgap42 T G 9: 8,997,655 K823T probably damaging Het
Bicc1 T C 10: 70,932,236 Y850C probably damaging Het
Cdh2 A T 18: 16,629,587 D433E probably damaging Het
Cfap100 A G 6: 90,413,710 probably null Het
Col6a5 T C 9: 105,931,009 N947D unknown Het
Col8a2 A G 4: 126,310,412 K72E possibly damaging Het
Ddx18 A G 1: 121,565,879 probably null Het
Dna2 T C 10: 62,947,154 V21A probably benign Het
Dnaja3 T A 16: 4,684,288 M52K probably benign Het
Fnip2 G A 3: 79,488,991 T504I probably damaging Het
Il18 G A 9: 50,577,893 probably null Het
Ina T A 19: 47,015,080 I109N probably damaging Het
Katnb1 G T 8: 95,095,470 V275L probably benign Het
Kdm6b C A 11: 69,400,768 probably benign Het
Kifc2 T A 15: 76,662,977 L251Q probably damaging Het
Kmt2d A G 15: 98,840,224 probably benign Het
Lcor T A 19: 41,555,614 V82E probably damaging Het
Limk2 A C 11: 3,350,772 V190G probably damaging Het
Luc7l A G 17: 26,267,297 D150G probably benign Het
Magi3 T A 3: 104,027,908 H903L possibly damaging Het
Mdh1b C T 1: 63,725,645 R33Q probably null Het
Myo9a T C 9: 59,871,802 F1614L probably benign Het
Ngly1 A G 14: 16,281,751 T210A probably damaging Het
Oas1h A G 5: 120,871,082 Y285C probably damaging Het
Olfr1252 T C 2: 89,721,419 R231G probably damaging Het
Olfr1382 T C 11: 49,535,689 L168P probably damaging Het
Olfr1413 C T 1: 92,573,822 T217I probably benign Het
Olfr209 C T 16: 59,361,766 G151R probably damaging Het
Olfr364-ps1 T A 2: 37,146,803 M197K probably benign Het
Olfr91 T C 17: 37,093,724 D50G possibly damaging Het
Osbpl7 T C 11: 97,054,556 S81P probably damaging Het
Pcdha3 T C 18: 36,946,427 V74A probably damaging Het
Pi4ka T C 16: 17,323,053 D68G probably benign Het
Prkcz A T 4: 155,293,232 V79D probably benign Het
Ptpn12 T A 5: 20,997,831 I650F probably damaging Het
Rb1 A G 14: 73,264,455 silent Het
Rnaseh2b T G 14: 62,353,531 Y56* probably null Het
Ryr3 A T 2: 112,646,927 C4495S probably damaging Het
Tk1 A G 11: 117,824,746 I45T possibly damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Upp1 T C 11: 9,135,193 S227P possibly damaging Het
Vmn1r30 T A 6: 58,435,383 N155Y probably benign Het
Wdr35 C T 12: 9,008,487 A548V probably damaging Het
Zc3h4 T C 7: 16,434,648 L894P unknown Het
Zfp790 C T 7: 29,829,767 H626Y probably benign Het
Zfp873 C T 10: 82,061,042 H536Y possibly damaging Het
Zmym4 A T 4: 126,870,184 N1354K probably damaging Het
Zscan20 A G 4: 128,592,482 S142P possibly damaging Het
Other mutations in Zc3h3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Zc3h3 APN 15 75779313 missense probably damaging 1.00
1mM(1):Zc3h3 UTSW 15 75840565 critical splice acceptor site probably null
R0477:Zc3h3 UTSW 15 75777083 missense possibly damaging 0.93
R0843:Zc3h3 UTSW 15 75837479 missense probably benign 0.00
R1891:Zc3h3 UTSW 15 75756931 missense possibly damaging 0.47
R1918:Zc3h3 UTSW 15 75777118 missense probably damaging 1.00
R2009:Zc3h3 UTSW 15 75779309 missense probably damaging 1.00
R2257:Zc3h3 UTSW 15 75839566 missense possibly damaging 0.77
R3853:Zc3h3 UTSW 15 75837497 missense probably benign 0.03
R5130:Zc3h3 UTSW 15 75779290 missense probably damaging 1.00
R5164:Zc3h3 UTSW 15 75777026 missense probably benign 0.02
R5279:Zc3h3 UTSW 15 75839590 missense probably benign 0.08
R5622:Zc3h3 UTSW 15 75777079 missense probably damaging 1.00
R5743:Zc3h3 UTSW 15 75779531 nonsense probably null
R5923:Zc3h3 UTSW 15 75785564 missense probably damaging 0.99
R6294:Zc3h3 UTSW 15 75809568 missense possibly damaging 0.90
R6377:Zc3h3 UTSW 15 75839455 missense probably damaging 0.99
R6735:Zc3h3 UTSW 15 75756634 missense probably benign 0.00
R7043:Zc3h3 UTSW 15 75809636 missense probably damaging 1.00
R7231:Zc3h3 UTSW 15 75840382 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCAACGTCCAGACAGTG -3'
(R):5'- GCTCTCCTGGAAGCCATACTAG -3'

Sequencing Primer
(F):5'- TCCAGACAGTGAGCACAGTATG -3'
(R):5'- TAGCCACCTCCTAAAGCCTCTG -3'
Posted On2016-06-21