Incidental Mutation 'R5161:Pmpca'
ID396975
Institutional Source Beutler Lab
Gene Symbol Pmpca
Ensembl Gene ENSMUSG00000026926
Gene Namepeptidase (mitochondrial processing) alpha
Synonyms4933435E07Rik, INPP5E, Alpha-MPP
MMRRC Submission 042743-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R5161 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26389339-26397122 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 26395171 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076431] [ENSMUST00000114090] [ENSMUST00000114093] [ENSMUST00000145701]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000028291
Predicted Effect probably null
Transcript: ENSMUST00000076431
SMART Domains Protein: ENSMUSP00000075762
Gene: ENSMUSG00000026926

DomainStartEndE-ValueType
Pfam:Peptidase_M16 76 226 4.5e-47 PFAM
Pfam:Peptidase_M16_C 231 430 4.1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114090
SMART Domains Protein: ENSMUSP00000109724
Gene: ENSMUSG00000026925

DomainStartEndE-ValueType
low complexity region 277 294 N/A INTRINSIC
IPPc 300 602 1.27e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114093
SMART Domains Protein: ENSMUSP00000109727
Gene: ENSMUSG00000026926

DomainStartEndE-ValueType
Pfam:Peptidase_M16 76 226 1.6e-47 PFAM
Pfam:Peptidase_M16_C 231 420 9.6e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131109
SMART Domains Protein: ENSMUSP00000118739
Gene: ENSMUSG00000026925

DomainStartEndE-ValueType
Pfam:Exo_endo_phos 4 88 6.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139535
Predicted Effect probably benign
Transcript: ENSMUST00000144011
SMART Domains Protein: ENSMUSP00000123272
Gene: ENSMUSG00000026925

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
IPPc 21 206 1.76e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145701
SMART Domains Protein: ENSMUSP00000119485
Gene: ENSMUSG00000026925

DomainStartEndE-ValueType
low complexity region 277 294 N/A INTRINSIC
IPPc 300 602 1.27e-62 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150907
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the mitochondrion, where it represents the alpha subunit of a proteolytic heterodimer. This heterodimer is responsible for cleaving the transit peptide from nuclear-encoded mitochondrial proteins. Defects in this gene are a cause of spinocerebellar ataxia, autosomal recessive 2. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,001 E27* probably null Het
1700061G19Rik A T 17: 56,882,888 I305F possibly damaging Het
3110035E14Rik G T 1: 9,622,677 G145* probably null Het
4930407I10Rik G T 15: 82,063,341 E480* probably null Het
Acad11 T C 9: 104,124,028 I591T probably benign Het
Adamts13 G A 2: 26,993,008 E857K probably benign Het
Apopt1 C A 12: 111,722,774 Q97K possibly damaging Het
Atf2 A C 2: 73,829,790 probably null Het
Cass4 C A 2: 172,432,324 A675E probably damaging Het
Ctsd A T 7: 142,377,144 L283Q probably damaging Het
Ddrgk1 A T 2: 130,663,376 M1K probably null Het
Dock1 G A 7: 134,734,062 A62T possibly damaging Het
Ehmt1 T C 2: 24,858,195 D407G possibly damaging Het
Eml6 A G 11: 30,024,467 V37A probably damaging Het
Fam20a C T 11: 109,673,370 R519Q probably benign Het
Fam69b C T 2: 26,636,248 T398M possibly damaging Het
Fat1 A G 8: 44,952,512 T767A probably benign Het
Fbxl8 A T 8: 105,268,906 H350L possibly damaging Het
Gm10226 A C 17: 21,691,927 Q23P possibly damaging Het
Gm17677 T A 9: 35,741,588 L42* probably null Het
Gm2075 T A 12: 88,012,117 D90E possibly damaging Het
Gm21994 A T 2: 150,255,215 I98K probably damaging Het
Gm38706 A T 6: 130,482,905 noncoding transcript Het
Gpatch2l G T 12: 86,267,176 R362L probably benign Het
H2afy T C 13: 56,089,781 D222G probably benign Het
Hyal5 A T 6: 24,891,603 D472V probably benign Het
Ighv5-9-1 T C 12: 113,736,157 S102G possibly damaging Het
Itpripl1 A C 2: 127,141,857 L115R probably damaging Het
Itsn1 G A 16: 91,908,838 C169Y possibly damaging Het
Krt88 T A 15: 101,450,468 C12S probably benign Het
Muc4 G A 16: 32,762,521 V2557M probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nbeal2 G T 9: 110,629,868 Q1996K probably benign Het
Obscn T C 11: 59,028,604 E6205G probably damaging Het
Obscn A G 11: 59,064,310 Y3926H possibly damaging Het
Olfr1436 A T 19: 12,298,789 S114R probably damaging Het
Olfr305 T C 7: 86,364,338 probably null Het
P2ry2 A T 7: 100,998,929 Y56* probably null Het
Pde1a T C 2: 79,878,144 N242S probably null Het
Pik3cg C T 12: 32,204,978 E337K possibly damaging Het
Plxna2 A G 1: 194,751,404 N587S probably benign Het
Ptpn4 C T 1: 119,707,863 W370* probably null Het
Qk A T 17: 10,215,490 probably null Het
Rapgef3 A G 15: 97,757,725 V427A probably damaging Het
Rbbp8 T G 18: 11,722,114 D465E probably damaging Het
Scn2a A G 2: 65,764,591 K1928R probably benign Het
Slc5a5 A C 8: 70,888,848 C346G probably damaging Het
Spata2l A G 8: 123,235,549 L91P probably damaging Het
Syt3 C A 7: 44,396,015 H560N possibly damaging Het
Timm23 G A 14: 32,193,925 P63L probably damaging Het
Tmem191c T C 16: 17,276,879 S108P possibly damaging Het
Ttc21b A G 2: 66,229,023 C545R probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp17ld A T 7: 103,250,372 L451* probably null Het
Vmn1r15 T C 6: 57,258,512 Y122H probably benign Het
Other mutations in Pmpca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02164:Pmpca APN 2 26395569 missense probably benign
R0064:Pmpca UTSW 2 26395507 missense probably benign 0.00
R0064:Pmpca UTSW 2 26395507 missense probably benign 0.00
R0690:Pmpca UTSW 2 26391097 missense probably damaging 1.00
R0864:Pmpca UTSW 2 26393209 splice site probably null
R0893:Pmpca UTSW 2 26393218 unclassified probably benign
R1386:Pmpca UTSW 2 26392518 missense probably damaging 0.98
R4541:Pmpca UTSW 2 26390189 unclassified probably benign
R4580:Pmpca UTSW 2 26393335 missense probably damaging 1.00
R4967:Pmpca UTSW 2 26390308 missense probably damaging 1.00
R4970:Pmpca UTSW 2 26395166 missense probably damaging 1.00
R5112:Pmpca UTSW 2 26395166 missense probably damaging 1.00
R5567:Pmpca UTSW 2 26390541 missense probably damaging 1.00
R5570:Pmpca UTSW 2 26390541 missense probably damaging 1.00
R6456:Pmpca UTSW 2 26395167 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACATGGAGATTTCTTTGCTGAG -3'
(R):5'- AGTGACCAGATGCCTCCTTC -3'

Sequencing Primer
(F):5'- TCTTGAGCCAGCTGTCGAG -3'
(R):5'- TTCCCAAGGCTGAGGAGC -3'
Posted On2016-06-21