Incidental Mutation 'R5161:Pde1a'
ID396981
Institutional Source Beutler Lab
Gene Symbol Pde1a
Ensembl Gene ENSMUSG00000059173
Gene Namephosphodiesterase 1A, calmodulin-dependent
Synonyms
MMRRC Submission 042743-MU
Accession Numbers

Genbank: NM_001159582, NM_016744, NM_001009978, NM_001009979

Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R5161 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location79834453-80129458 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79878144 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 242 (N242S)
Ref Sequence ENSEMBL: ENSMUSP00000099711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090756] [ENSMUST00000102651] [ENSMUST00000102652] [ENSMUST00000102653] [ENSMUST00000102654] [ENSMUST00000102655] [ENSMUST00000183775]
Predicted Effect probably null
Transcript: ENSMUST00000090756
AA Change: N206S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088260
Gene: ENSMUSG00000059173
AA Change: N206S

DomainStartEndE-ValueType
Pfam:PDEase_I_N 1 29 3.4e-11 PFAM
HDc 112 276 5.19e-7 SMART
low complexity region 344 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102651
AA Change: N242S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099711
Gene: ENSMUSG00000059173
AA Change: N242S

DomainStartEndE-ValueType
Pfam:PDEase_I_N 5 65 9.3e-32 PFAM
HDc 148 312 5.19e-7 SMART
low complexity region 380 393 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102652
AA Change: N242S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099712
Gene: ENSMUSG00000059173
AA Change: N242S

DomainStartEndE-ValueType
Pfam:PDEase_I_N 5 65 9e-32 PFAM
HDc 148 312 5.19e-7 SMART
low complexity region 380 393 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102653
AA Change: N310S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099713
Gene: ENSMUSG00000059173
AA Change: N310S

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 1.2e-31 PFAM
HDc 216 380 5.19e-7 SMART
low complexity region 448 461 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102654
AA Change: N310S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099714
Gene: ENSMUSG00000059173
AA Change: N310S

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 1.2e-31 PFAM
HDc 216 380 5.19e-7 SMART
low complexity region 448 461 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102655
AA Change: N310S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099715
Gene: ENSMUSG00000059173
AA Change: N310S

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 7.8e-35 PFAM
HDc 216 380 5.19e-7 SMART
low complexity region 448 461 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000134739
AA Change: N277S
SMART Domains Protein: ENSMUSP00000120188
Gene: ENSMUSG00000059173
AA Change: N277S

DomainStartEndE-ValueType
Pfam:PDEase_I_N 41 101 1.4e-35 PFAM
HDc 184 348 5.19e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183775
AA Change: N310S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139327
Gene: ENSMUSG00000059173
AA Change: N310S

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 1.2e-31 PFAM
HDc 216 380 5.19e-7 SMART
low complexity region 448 461 N/A INTRINSIC
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cyclic nucleotide phosphodiesterases (PDEs) play a role in signal transduction by regulating intracellular cyclic nucleotide concentrations through hydrolysis of cAMP and/or cGMP to their respective nucleoside 5-prime monophosphates. Members of the PDE1 family, such as PDE1A, are Ca(2+)/calmodulin (see CALM1; MIM 114180)-dependent PDEs (CaM-PDEs) that are activated by calmodulin in the presence of Ca(2+) (Michibata et al., 2001 [PubMed 11342109]; Fidock et al., 2002 [PubMed 11747989]).[supplied by OMIM, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,001 E27* probably null Het
1700061G19Rik A T 17: 56,882,888 I305F possibly damaging Het
3110035E14Rik G T 1: 9,622,677 G145* probably null Het
4930407I10Rik G T 15: 82,063,341 E480* probably null Het
Acad11 T C 9: 104,124,028 I591T probably benign Het
Adamts13 G A 2: 26,993,008 E857K probably benign Het
Apopt1 C A 12: 111,722,774 Q97K possibly damaging Het
Atf2 A C 2: 73,829,790 probably null Het
Cass4 C A 2: 172,432,324 A675E probably damaging Het
Ctsd A T 7: 142,377,144 L283Q probably damaging Het
Ddrgk1 A T 2: 130,663,376 M1K probably null Het
Dock1 G A 7: 134,734,062 A62T possibly damaging Het
Ehmt1 T C 2: 24,858,195 D407G possibly damaging Het
Eml6 A G 11: 30,024,467 V37A probably damaging Het
Fam20a C T 11: 109,673,370 R519Q probably benign Het
Fam69b C T 2: 26,636,248 T398M possibly damaging Het
Fat1 A G 8: 44,952,512 T767A probably benign Het
Fbxl8 A T 8: 105,268,906 H350L possibly damaging Het
Gm10226 A C 17: 21,691,927 Q23P possibly damaging Het
Gm17677 T A 9: 35,741,588 L42* probably null Het
Gm2075 T A 12: 88,012,117 D90E possibly damaging Het
Gm21994 A T 2: 150,255,215 I98K probably damaging Het
Gm38706 A T 6: 130,482,905 noncoding transcript Het
Gpatch2l G T 12: 86,267,176 R362L probably benign Het
H2afy T C 13: 56,089,781 D222G probably benign Het
Hyal5 A T 6: 24,891,603 D472V probably benign Het
Ighv5-9-1 T C 12: 113,736,157 S102G possibly damaging Het
Itpripl1 A C 2: 127,141,857 L115R probably damaging Het
Itsn1 G A 16: 91,908,838 C169Y possibly damaging Het
Krt88 T A 15: 101,450,468 C12S probably benign Het
Muc4 G A 16: 32,762,521 V2557M probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nbeal2 G T 9: 110,629,868 Q1996K probably benign Het
Obscn T C 11: 59,028,604 E6205G probably damaging Het
Obscn A G 11: 59,064,310 Y3926H possibly damaging Het
Olfr1436 A T 19: 12,298,789 S114R probably damaging Het
Olfr305 T C 7: 86,364,338 probably null Het
P2ry2 A T 7: 100,998,929 Y56* probably null Het
Pik3cg C T 12: 32,204,978 E337K possibly damaging Het
Plxna2 A G 1: 194,751,404 N587S probably benign Het
Pmpca T C 2: 26,395,171 probably null Het
Ptpn4 C T 1: 119,707,863 W370* probably null Het
Qk A T 17: 10,215,490 probably null Het
Rapgef3 A G 15: 97,757,725 V427A probably damaging Het
Rbbp8 T G 18: 11,722,114 D465E probably damaging Het
Scn2a A G 2: 65,764,591 K1928R probably benign Het
Slc5a5 A C 8: 70,888,848 C346G probably damaging Het
Spata2l A G 8: 123,235,549 L91P probably damaging Het
Syt3 C A 7: 44,396,015 H560N possibly damaging Het
Timm23 G A 14: 32,193,925 P63L probably damaging Het
Tmem191c T C 16: 17,276,879 S108P possibly damaging Het
Ttc21b A G 2: 66,229,023 C545R probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp17ld A T 7: 103,250,372 L451* probably null Het
Vmn1r15 T C 6: 57,258,512 Y122H probably benign Het
Other mutations in Pde1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Pde1a APN 2 79865670 missense probably damaging 1.00
IGL01860:Pde1a APN 2 79875284 missense probably damaging 1.00
IGL02059:Pde1a APN 2 79897077 missense possibly damaging 0.64
IGL02307:Pde1a APN 2 79906068 missense possibly damaging 0.70
IGL02376:Pde1a APN 2 79875223 splice site probably benign
IGL02569:Pde1a APN 2 79868258 missense probably benign 0.04
IGL03038:Pde1a APN 2 79887946 splice site probably benign
G5030:Pde1a UTSW 2 79887836 splice site probably benign
R0099:Pde1a UTSW 2 79868313 critical splice acceptor site probably null
R0549:Pde1a UTSW 2 79865070 missense probably damaging 1.00
R0960:Pde1a UTSW 2 79865034 splice site probably benign
R1855:Pde1a UTSW 2 79898064 critical splice donor site probably null
R1907:Pde1a UTSW 2 79868307 missense probably damaging 1.00
R1972:Pde1a UTSW 2 79865721 missense probably damaging 0.99
R2262:Pde1a UTSW 2 80128931 start gained probably benign
R4658:Pde1a UTSW 2 79898181 critical splice acceptor site probably benign
R4674:Pde1a UTSW 2 79898181 critical splice acceptor site probably benign
R4842:Pde1a UTSW 2 80128837 utr 5 prime probably benign
R4878:Pde1a UTSW 2 79878139 missense probably benign 0.05
R5473:Pde1a UTSW 2 79906028 missense probably damaging 1.00
R5940:Pde1a UTSW 2 79887839 critical splice donor site probably null
R5976:Pde1a UTSW 2 79868242 nonsense probably null
R6016:Pde1a UTSW 2 79865062 missense probably benign 0.01
R6242:Pde1a UTSW 2 80128792 missense probably benign
R6248:Pde1a UTSW 2 79878201 missense probably damaging 1.00
R6609:Pde1a UTSW 2 79906140 missense probably damaging 1.00
R6858:Pde1a UTSW 2 80129158 unclassified probably benign
X0025:Pde1a UTSW 2 79838930 makesense probably null
Predicted Primers PCR Primer
(F):5'- GGCTTTACACATGTGCTAGGG -3'
(R):5'- GTGTGATGACTACTTACTATGGAAACC -3'

Sequencing Primer
(F):5'- AGTTTCTGTCTATCCAGCAGCAGAG -3'
(R):5'- CTATGGAAACCTCAAAGTCTGAAG -3'
Posted On2016-06-21