Incidental Mutation 'R5161:Gm21994'
ID396984
Institutional Source Beutler Lab
Gene Symbol Gm21994
Ensembl Gene ENSMUSG00000074735
Gene Namepredicted gene 21994
Synonyms
MMRRC Submission 042743-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R5161 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location150254518-150255591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 150255215 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 98 (I98K)
Ref Sequence ENSEMBL: ENSMUSP00000075719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063463] [ENSMUST00000109922]
Predicted Effect probably damaging
Transcript: ENSMUST00000063463
AA Change: I98K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075719
Gene: ENSMUSG00000074735
AA Change: I98K

DomainStartEndE-ValueType
ZnF_C2H2 1 18 2.7e2 SMART
ZnF_C2H2 53 73 2.75e1 SMART
ZnF_C2H2 77 99 6.42e-4 SMART
ZnF_C2H2 132 154 1.58e-3 SMART
ZnF_C2H2 160 182 1.12e-3 SMART
ZnF_C2H2 188 210 4.01e-5 SMART
ZnF_C2H2 216 238 3.16e-3 SMART
ZnF_C2H2 244 266 8.94e-3 SMART
ZnF_C2H2 272 294 9.58e-3 SMART
ZnF_C2H2 300 322 1.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109922
SMART Domains Protein: ENSMUSP00000105548
Gene: ENSMUSG00000079008

DomainStartEndE-ValueType
KRAB 4 66 9.26e-19 SMART
ZnF_C2H2 103 125 7.49e-5 SMART
ZnF_C2H2 131 151 9.46e0 SMART
ZnF_C2H2 159 181 5.9e-3 SMART
ZnF_C2H2 187 209 6.67e-2 SMART
ZnF_C2H2 215 237 4.87e-4 SMART
ZnF_C2H2 243 265 2.82e0 SMART
ZnF_C2H2 271 293 2.2e2 SMART
ZnF_C2H2 299 321 1.4e-4 SMART
ZnF_C2H2 327 349 1.6e-4 SMART
ZnF_C2H2 355 377 1.18e-2 SMART
ZnF_C2H2 383 405 1.38e-3 SMART
ZnF_C2H2 411 433 9.56e1 SMART
ZnF_C2H2 439 461 6.99e-5 SMART
ZnF_C2H2 467 489 2.99e-4 SMART
ZnF_C2H2 495 517 7.78e-3 SMART
ZnF_C2H2 523 545 1.04e-3 SMART
ZnF_C2H2 551 573 1.6e-4 SMART
ZnF_C2H2 579 601 1.18e-2 SMART
ZnF_C2H2 607 629 4.54e-4 SMART
ZnF_C2H2 635 657 4.24e-4 SMART
ZnF_C2H2 663 685 1.2e-3 SMART
ZnF_C2H2 691 713 8.47e-4 SMART
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,001 E27* probably null Het
1700061G19Rik A T 17: 56,882,888 I305F possibly damaging Het
3110035E14Rik G T 1: 9,622,677 G145* probably null Het
4930407I10Rik G T 15: 82,063,341 E480* probably null Het
Acad11 T C 9: 104,124,028 I591T probably benign Het
Adamts13 G A 2: 26,993,008 E857K probably benign Het
Apopt1 C A 12: 111,722,774 Q97K possibly damaging Het
Atf2 A C 2: 73,829,790 probably null Het
Cass4 C A 2: 172,432,324 A675E probably damaging Het
Ctsd A T 7: 142,377,144 L283Q probably damaging Het
Ddrgk1 A T 2: 130,663,376 M1K probably null Het
Dock1 G A 7: 134,734,062 A62T possibly damaging Het
Ehmt1 T C 2: 24,858,195 D407G possibly damaging Het
Eml6 A G 11: 30,024,467 V37A probably damaging Het
Fam20a C T 11: 109,673,370 R519Q probably benign Het
Fam69b C T 2: 26,636,248 T398M possibly damaging Het
Fat1 A G 8: 44,952,512 T767A probably benign Het
Fbxl8 A T 8: 105,268,906 H350L possibly damaging Het
Gm10226 A C 17: 21,691,927 Q23P possibly damaging Het
Gm17677 T A 9: 35,741,588 L42* probably null Het
Gm2075 T A 12: 88,012,117 D90E possibly damaging Het
Gm38706 A T 6: 130,482,905 noncoding transcript Het
Gpatch2l G T 12: 86,267,176 R362L probably benign Het
H2afy T C 13: 56,089,781 D222G probably benign Het
Hyal5 A T 6: 24,891,603 D472V probably benign Het
Ighv5-9-1 T C 12: 113,736,157 S102G possibly damaging Het
Itpripl1 A C 2: 127,141,857 L115R probably damaging Het
Itsn1 G A 16: 91,908,838 C169Y possibly damaging Het
Krt88 T A 15: 101,450,468 C12S probably benign Het
Muc4 G A 16: 32,762,521 V2557M probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nbeal2 G T 9: 110,629,868 Q1996K probably benign Het
Obscn T C 11: 59,028,604 E6205G probably damaging Het
Obscn A G 11: 59,064,310 Y3926H possibly damaging Het
Olfr1436 A T 19: 12,298,789 S114R probably damaging Het
Olfr305 T C 7: 86,364,338 probably null Het
P2ry2 A T 7: 100,998,929 Y56* probably null Het
Pde1a T C 2: 79,878,144 N242S probably null Het
Pik3cg C T 12: 32,204,978 E337K possibly damaging Het
Plxna2 A G 1: 194,751,404 N587S probably benign Het
Pmpca T C 2: 26,395,171 probably null Het
Ptpn4 C T 1: 119,707,863 W370* probably null Het
Qk A T 17: 10,215,490 probably null Het
Rapgef3 A G 15: 97,757,725 V427A probably damaging Het
Rbbp8 T G 18: 11,722,114 D465E probably damaging Het
Scn2a A G 2: 65,764,591 K1928R probably benign Het
Slc5a5 A C 8: 70,888,848 C346G probably damaging Het
Spata2l A G 8: 123,235,549 L91P probably damaging Het
Syt3 C A 7: 44,396,015 H560N possibly damaging Het
Timm23 G A 14: 32,193,925 P63L probably damaging Het
Tmem191c T C 16: 17,276,879 S108P possibly damaging Het
Ttc21b A G 2: 66,229,023 C545R probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp17ld A T 7: 103,250,372 L451* probably null Het
Vmn1r15 T C 6: 57,258,512 Y122H probably benign Het
Other mutations in Gm21994
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6648_Gm21994_337 UTSW 2 150255177 missense probably benign 0.01
R0853:Gm21994 UTSW 2 150255478 missense probably benign 0.30
R5135:Gm21994 UTSW 2 150255490 nonsense probably null
R5782:Gm21994 UTSW 2 150255518 missense probably benign 0.41
R6019:Gm21994 UTSW 2 150255212 missense probably damaging 1.00
R6284:Gm21994 UTSW 2 150255278 missense possibly damaging 0.95
R6476:Gm21994 UTSW 2 150255326 missense probably benign 0.00
R6479:Gm21994 UTSW 2 150254591 missense probably damaging 0.99
R6648:Gm21994 UTSW 2 150255177 missense probably benign 0.01
R6736:Gm21994 UTSW 2 150255278 missense possibly damaging 0.95
R6963:Gm21994 UTSW 2 150255345 missense probably damaging 1.00
R7014:Gm21994 UTSW 2 150255262 nonsense probably null
R7138:Gm21994 UTSW 2 150255452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGTTTCTCTCCAGTATGTG -3'
(R):5'- TCAACTTGGGAAGAAAGCCTATG -3'

Sequencing Primer
(F):5'- TTCTCTCCAGTATGTGTTCTTTTATG -3'
(R):5'- GTGTCCAACATTGTGAAGCC -3'
Posted On2016-06-21