Incidental Mutation 'R5161:Myh7b'
ID396985
Institutional Source Beutler Lab
Gene Symbol Myh7b
Ensembl Gene ENSMUSG00000074652
Gene Namemyosin, heavy chain 7B, cardiac muscle, beta
SynonymsMyh14
MMRRC Submission 042743-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5161 (G1)
Quality Score90
Status Validated
Chromosome2
Chromosomal Location155611212-155634307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 155632373 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 1669 (R1669S)
Ref Sequence ENSEMBL: ENSMUSP00000090672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041059] [ENSMUST00000092995] [ENSMUST00000103140]
Predicted Effect probably benign
Transcript: ENSMUST00000041059
SMART Domains Protein: ENSMUSP00000037574
Gene: ENSMUSG00000038324

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 407 714 5.2e-135 PFAM
low complexity region 724 735 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000092995
AA Change: R1669S

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: R1669S

DomainStartEndE-ValueType
Pfam:Myosin_N 32 72 4.7e-14 PFAM
MYSc 78 786 N/A SMART
IQ 787 809 2.6e0 SMART
Pfam:Myosin_tail_1 850 1931 5.5e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103140
SMART Domains Protein: ENSMUSP00000099429
Gene: ENSMUSG00000038324

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 38 53 N/A INTRINSIC
Pfam:DUF3689 399 710 1.1e-138 PFAM
low complexity region 716 727 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154656
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,001 E27* probably null Het
1700061G19Rik A T 17: 56,882,888 I305F possibly damaging Het
3110035E14Rik G T 1: 9,622,677 G145* probably null Het
4930407I10Rik G T 15: 82,063,341 E480* probably null Het
Acad11 T C 9: 104,124,028 I591T probably benign Het
Adamts13 G A 2: 26,993,008 E857K probably benign Het
Apopt1 C A 12: 111,722,774 Q97K possibly damaging Het
Atf2 A C 2: 73,829,790 probably null Het
Cass4 C A 2: 172,432,324 A675E probably damaging Het
Ctsd A T 7: 142,377,144 L283Q probably damaging Het
Ddrgk1 A T 2: 130,663,376 M1K probably null Het
Dock1 G A 7: 134,734,062 A62T possibly damaging Het
Ehmt1 T C 2: 24,858,195 D407G possibly damaging Het
Eml6 A G 11: 30,024,467 V37A probably damaging Het
Fam20a C T 11: 109,673,370 R519Q probably benign Het
Fam69b C T 2: 26,636,248 T398M possibly damaging Het
Fat1 A G 8: 44,952,512 T767A probably benign Het
Fbxl8 A T 8: 105,268,906 H350L possibly damaging Het
Gm10226 A C 17: 21,691,927 Q23P possibly damaging Het
Gm17677 T A 9: 35,741,588 L42* probably null Het
Gm2075 T A 12: 88,012,117 D90E possibly damaging Het
Gm21994 A T 2: 150,255,215 I98K probably damaging Het
Gm38706 A T 6: 130,482,905 noncoding transcript Het
Gpatch2l G T 12: 86,267,176 R362L probably benign Het
H2afy T C 13: 56,089,781 D222G probably benign Het
Hyal5 A T 6: 24,891,603 D472V probably benign Het
Ighv5-9-1 T C 12: 113,736,157 S102G possibly damaging Het
Itpripl1 A C 2: 127,141,857 L115R probably damaging Het
Itsn1 G A 16: 91,908,838 C169Y possibly damaging Het
Krt88 T A 15: 101,450,468 C12S probably benign Het
Muc4 G A 16: 32,762,521 V2557M probably damaging Het
Nbeal2 G T 9: 110,629,868 Q1996K probably benign Het
Obscn T C 11: 59,028,604 E6205G probably damaging Het
Obscn A G 11: 59,064,310 Y3926H possibly damaging Het
Olfr1436 A T 19: 12,298,789 S114R probably damaging Het
Olfr305 T C 7: 86,364,338 probably null Het
P2ry2 A T 7: 100,998,929 Y56* probably null Het
Pde1a T C 2: 79,878,144 N242S probably null Het
Pik3cg C T 12: 32,204,978 E337K possibly damaging Het
Plxna2 A G 1: 194,751,404 N587S probably benign Het
Pmpca T C 2: 26,395,171 probably null Het
Ptpn4 C T 1: 119,707,863 W370* probably null Het
Qk A T 17: 10,215,490 probably null Het
Rapgef3 A G 15: 97,757,725 V427A probably damaging Het
Rbbp8 T G 18: 11,722,114 D465E probably damaging Het
Scn2a A G 2: 65,764,591 K1928R probably benign Het
Slc5a5 A C 8: 70,888,848 C346G probably damaging Het
Spata2l A G 8: 123,235,549 L91P probably damaging Het
Syt3 C A 7: 44,396,015 H560N possibly damaging Het
Timm23 G A 14: 32,193,925 P63L probably damaging Het
Tmem191c T C 16: 17,276,879 S108P possibly damaging Het
Ttc21b A G 2: 66,229,023 C545R probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp17ld A T 7: 103,250,372 L451* probably null Het
Vmn1r15 T C 6: 57,258,512 Y122H probably benign Het
Other mutations in Myh7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Myh7b APN 2 155630292 missense probably damaging 0.99
IGL01604:Myh7b APN 2 155632407 missense probably damaging 0.96
IGL02179:Myh7b APN 2 155614491 missense probably benign 0.02
IGL02729:Myh7b APN 2 155625689 missense probably damaging 1.00
IGL02804:Myh7b APN 2 155625723 missense probably damaging 1.00
IGL02851:Myh7b APN 2 155628827 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155632903 missense probably damaging 1.00
IGL02956:Myh7b APN 2 155625954 missense possibly damaging 0.95
IGL02992:Myh7b APN 2 155621410 missense probably damaging 0.99
IGL03060:Myh7b APN 2 155632751 missense probably damaging 1.00
IGL03061:Myh7b APN 2 155620111 missense possibly damaging 0.93
IGL03226:Myh7b APN 2 155620483 nonsense probably null
IGL03246:Myh7b APN 2 155617872 missense probably damaging 1.00
IGL03382:Myh7b APN 2 155623479 missense probably damaging 1.00
euclidian UTSW 2 155633399 missense probably benign 0.32
imaginary UTSW 2 155632255 missense probably benign 0.36
irrational UTSW 2 155630672 unclassified probably benign
muscoli UTSW 2 155620118 nonsense probably null
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0015:Myh7b UTSW 2 155622286 missense probably damaging 1.00
R0109:Myh7b UTSW 2 155611674 missense possibly damaging 0.92
R0309:Myh7b UTSW 2 155630672 unclassified probably benign
R0567:Myh7b UTSW 2 155626398 missense probably damaging 1.00
R0619:Myh7b UTSW 2 155611722 missense probably benign 0.00
R0927:Myh7b UTSW 2 155620120 missense probably damaging 1.00
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0973:Myh7b UTSW 2 155620427 missense probably benign
R0974:Myh7b UTSW 2 155620427 missense probably benign
R1137:Myh7b UTSW 2 155622714 missense probably damaging 1.00
R1261:Myh7b UTSW 2 155621083 missense probably benign 0.00
R1268:Myh7b UTSW 2 155614046 nonsense probably null
R1537:Myh7b UTSW 2 155631787 missense probably damaging 0.96
R1632:Myh7b UTSW 2 155620525 missense probably benign 0.04
R1694:Myh7b UTSW 2 155613193 missense probably damaging 0.99
R1697:Myh7b UTSW 2 155620134 missense probably damaging 1.00
R1730:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R1762:Myh7b UTSW 2 155630858 missense probably damaging 0.96
R1783:Myh7b UTSW 2 155625672 missense possibly damaging 0.73
R2105:Myh7b UTSW 2 155629457 missense probably benign 0.00
R2140:Myh7b UTSW 2 155620123 missense probably damaging 1.00
R2971:Myh7b UTSW 2 155632255 missense probably benign 0.36
R3838:Myh7b UTSW 2 155632989 missense probably damaging 1.00
R4074:Myh7b UTSW 2 155618758 missense probably damaging 0.96
R4191:Myh7b UTSW 2 155633399 missense probably benign 0.32
R4689:Myh7b UTSW 2 155630514 missense possibly damaging 0.75
R4695:Myh7b UTSW 2 155614177 missense probably damaging 1.00
R4697:Myh7b UTSW 2 155629322 missense probably damaging 1.00
R4771:Myh7b UTSW 2 155626394 nonsense probably null
R4794:Myh7b UTSW 2 155623266 missense probably benign 0.00
R4842:Myh7b UTSW 2 155633989 missense probably benign 0.45
R4871:Myh7b UTSW 2 155613500 missense probably benign 0.18
R5022:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5023:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5025:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5050:Myh7b UTSW 2 155631750 missense probably benign 0.00
R5055:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5056:Myh7b UTSW 2 155632373 missense possibly damaging 0.75
R5284:Myh7b UTSW 2 155632314 missense probably benign
R5422:Myh7b UTSW 2 155631034 missense probably damaging 0.99
R5505:Myh7b UTSW 2 155632672 missense probably benign 0.01
R5946:Myh7b UTSW 2 155621395 missense probably damaging 1.00
R6089:Myh7b UTSW 2 155622489 missense probably damaging 1.00
R6103:Myh7b UTSW 2 155618743 missense probably damaging 1.00
R6233:Myh7b UTSW 2 155631799 missense possibly damaging 0.85
R6292:Myh7b UTSW 2 155632396 missense probably damaging 1.00
R6350:Myh7b UTSW 2 155628760 missense probably benign 0.00
R6484:Myh7b UTSW 2 155628643 missense probably benign 0.05
R6760:Myh7b UTSW 2 155620118 nonsense probably null
R6896:Myh7b UTSW 2 155622568 critical splice donor site probably null
R6945:Myh7b UTSW 2 155622232 missense possibly damaging 0.95
R7020:Myh7b UTSW 2 155631751 missense possibly damaging 0.56
R7052:Myh7b UTSW 2 155614133 missense probably damaging 1.00
R7102:Myh7b UTSW 2 155622199 missense probably damaging 1.00
R7248:Myh7b UTSW 2 155622186 missense probably damaging 1.00
R7303:Myh7b UTSW 2 155618740 missense probably damaging 1.00
R7360:Myh7b UTSW 2 155632540 missense probably benign 0.38
X0013:Myh7b UTSW 2 155631169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTAATGCCTGACCTACTCC -3'
(R):5'- AATGCAGTAGGTTGAGGCGC -3'

Sequencing Primer
(F):5'- CTCCCTGGATGCAGAGACAAG -3'
(R):5'- TTGAGGCGCTCGGTGGC -3'
Posted On2016-06-21