Incidental Mutation 'R5161:Eml6'
ID397005
Institutional Source Beutler Lab
Gene Symbol Eml6
Ensembl Gene ENSMUSG00000044072
Gene Nameechinoderm microtubule associated protein like 6
Synonyms
MMRRC Submission 042743-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R5161 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location29743048-30026033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30024467 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 37 (V37A)
Ref Sequence ENSEMBL: ENSMUSP00000051080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902]
Predicted Effect probably damaging
Transcript: ENSMUST00000058902
AA Change: V37A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072
AA Change: V37A

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,001 E27* probably null Het
1700061G19Rik A T 17: 56,882,888 I305F possibly damaging Het
3110035E14Rik G T 1: 9,622,677 G145* probably null Het
4930407I10Rik G T 15: 82,063,341 E480* probably null Het
Acad11 T C 9: 104,124,028 I591T probably benign Het
Adamts13 G A 2: 26,993,008 E857K probably benign Het
Apopt1 C A 12: 111,722,774 Q97K possibly damaging Het
Atf2 A C 2: 73,829,790 probably null Het
Cass4 C A 2: 172,432,324 A675E probably damaging Het
Ctsd A T 7: 142,377,144 L283Q probably damaging Het
Ddrgk1 A T 2: 130,663,376 M1K probably null Het
Dock1 G A 7: 134,734,062 A62T possibly damaging Het
Ehmt1 T C 2: 24,858,195 D407G possibly damaging Het
Fam20a C T 11: 109,673,370 R519Q probably benign Het
Fam69b C T 2: 26,636,248 T398M possibly damaging Het
Fat1 A G 8: 44,952,512 T767A probably benign Het
Fbxl8 A T 8: 105,268,906 H350L possibly damaging Het
Gm10226 A C 17: 21,691,927 Q23P possibly damaging Het
Gm17677 T A 9: 35,741,588 L42* probably null Het
Gm2075 T A 12: 88,012,117 D90E possibly damaging Het
Gm21994 A T 2: 150,255,215 I98K probably damaging Het
Gm38706 A T 6: 130,482,905 noncoding transcript Het
Gpatch2l G T 12: 86,267,176 R362L probably benign Het
H2afy T C 13: 56,089,781 D222G probably benign Het
Hyal5 A T 6: 24,891,603 D472V probably benign Het
Ighv5-9-1 T C 12: 113,736,157 S102G possibly damaging Het
Itpripl1 A C 2: 127,141,857 L115R probably damaging Het
Itsn1 G A 16: 91,908,838 C169Y possibly damaging Het
Krt88 T A 15: 101,450,468 C12S probably benign Het
Muc4 G A 16: 32,762,521 V2557M probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nbeal2 G T 9: 110,629,868 Q1996K probably benign Het
Obscn T C 11: 59,028,604 E6205G probably damaging Het
Obscn A G 11: 59,064,310 Y3926H possibly damaging Het
Olfr1436 A T 19: 12,298,789 S114R probably damaging Het
Olfr305 T C 7: 86,364,338 probably null Het
P2ry2 A T 7: 100,998,929 Y56* probably null Het
Pde1a T C 2: 79,878,144 N242S probably null Het
Pik3cg C T 12: 32,204,978 E337K possibly damaging Het
Plxna2 A G 1: 194,751,404 N587S probably benign Het
Pmpca T C 2: 26,395,171 probably null Het
Ptpn4 C T 1: 119,707,863 W370* probably null Het
Qk A T 17: 10,215,490 probably null Het
Rapgef3 A G 15: 97,757,725 V427A probably damaging Het
Rbbp8 T G 18: 11,722,114 D465E probably damaging Het
Scn2a A G 2: 65,764,591 K1928R probably benign Het
Slc5a5 A C 8: 70,888,848 C346G probably damaging Het
Spata2l A G 8: 123,235,549 L91P probably damaging Het
Syt3 C A 7: 44,396,015 H560N possibly damaging Het
Timm23 G A 14: 32,193,925 P63L probably damaging Het
Tmem191c T C 16: 17,276,879 S108P possibly damaging Het
Ttc21b A G 2: 66,229,023 C545R probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp17ld A T 7: 103,250,372 L451* probably null Het
Vmn1r15 T C 6: 57,258,512 Y122H probably benign Het
Other mutations in Eml6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Eml6 APN 11 29850816 critical splice donor site probably null
IGL01407:Eml6 APN 11 29755021 nonsense probably null
IGL01434:Eml6 APN 11 29819090 missense probably damaging 1.00
IGL01578:Eml6 APN 11 29850870 missense probably benign 0.02
IGL01780:Eml6 APN 11 29805175 missense probably benign 0.17
IGL01821:Eml6 APN 11 29821699 missense probably benign 0.00
IGL01837:Eml6 APN 11 29777055 missense probably benign 0.00
IGL01904:Eml6 APN 11 29838613 nonsense probably null
IGL01972:Eml6 APN 11 29838451 missense possibly damaging 0.67
IGL02134:Eml6 APN 11 29759066 missense probably benign 0.13
IGL02192:Eml6 APN 11 29805743 missense probably benign 0.00
IGL02377:Eml6 APN 11 29777282 missense probably damaging 0.98
IGL02584:Eml6 APN 11 29749387 missense probably damaging 0.99
IGL02587:Eml6 APN 11 29784236 missense possibly damaging 0.92
IGL02810:Eml6 APN 11 29849016 missense possibly damaging 0.94
IGL02873:Eml6 APN 11 29880700 missense probably benign 0.10
IGL02880:Eml6 APN 11 29749959 missense probably benign 0.03
IGL03289:Eml6 APN 11 29795328 missense possibly damaging 0.49
IGL03301:Eml6 APN 11 29764083 missense probably benign 0.18
IGL03386:Eml6 APN 11 29749934 missense probably benign
IGL03407:Eml6 APN 11 29906330 missense probably damaging 1.00
PIT4453001:Eml6 UTSW 11 29802489 missense probably damaging 1.00
R0125:Eml6 UTSW 11 29882088 missense probably benign 0.19
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0271:Eml6 UTSW 11 29848949 missense possibly damaging 0.48
R0304:Eml6 UTSW 11 29777441 missense probably benign 0.00
R0415:Eml6 UTSW 11 29749392 missense possibly damaging 0.84
R0449:Eml6 UTSW 11 29893213 missense probably benign 0.01
R0538:Eml6 UTSW 11 29760010 splice site probably benign
R0671:Eml6 UTSW 11 29805065 missense probably benign 0.00
R0766:Eml6 UTSW 11 29831219 splice site probably benign
R0800:Eml6 UTSW 11 29749877 missense probably benign 0.08
R0841:Eml6 UTSW 11 29777430 missense probably benign 0.41
R0879:Eml6 UTSW 11 29850816 critical splice donor site probably null
R1061:Eml6 UTSW 11 29777267 missense probably damaging 1.00
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1172:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1173:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1174:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1199:Eml6 UTSW 11 29755044 missense possibly damaging 0.93
R1311:Eml6 UTSW 11 29831088 splice site probably benign
R1312:Eml6 UTSW 11 29831219 splice site probably benign
R1355:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1370:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1457:Eml6 UTSW 11 30024459 missense probably damaging 1.00
R1486:Eml6 UTSW 11 29805114 missense possibly damaging 0.83
R1511:Eml6 UTSW 11 29818374 missense probably damaging 1.00
R1532:Eml6 UTSW 11 29792256 splice site probably null
R1642:Eml6 UTSW 11 29777001 critical splice donor site probably null
R1682:Eml6 UTSW 11 29759065 missense probably benign 0.13
R1687:Eml6 UTSW 11 29833187 missense probably damaging 1.00
R1699:Eml6 UTSW 11 29746282 nonsense probably null
R1796:Eml6 UTSW 11 29881975 missense probably benign 0.19
R1797:Eml6 UTSW 11 29882041 missense probably benign 0.09
R1837:Eml6 UTSW 11 29749802 splice site probably null
R1874:Eml6 UTSW 11 29831136 missense probably damaging 0.99
R1967:Eml6 UTSW 11 30024545 missense probably damaging 1.00
R1969:Eml6 UTSW 11 29833075 missense probably benign
R2007:Eml6 UTSW 11 29848814 critical splice donor site probably null
R2012:Eml6 UTSW 11 29831128 missense possibly damaging 0.85
R2198:Eml6 UTSW 11 29850935 missense probably benign 0.01
R2217:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2218:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2403:Eml6 UTSW 11 29802434 missense probably benign 0.05
R2520:Eml6 UTSW 11 29791993 missense probably damaging 1.00
R2937:Eml6 UTSW 11 29833049 splice site probably benign
R2938:Eml6 UTSW 11 29833049 splice site probably benign
R3085:Eml6 UTSW 11 29809332 missense probably damaging 0.96
R3236:Eml6 UTSW 11 29831097 critical splice donor site probably null
R3738:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3739:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3752:Eml6 UTSW 11 29809360 missense probably benign 0.06
R3854:Eml6 UTSW 11 29749905 missense possibly damaging 0.76
R3941:Eml6 UTSW 11 29803167 missense probably damaging 0.98
R4034:Eml6 UTSW 11 29803137 missense probably benign 0.20
R4049:Eml6 UTSW 11 29838577 missense probably damaging 1.00
R4108:Eml6 UTSW 11 29805136 missense probably damaging 0.98
R4657:Eml6 UTSW 11 29805108 missense possibly damaging 0.77
R4662:Eml6 UTSW 11 29777390 missense probably damaging 1.00
R4665:Eml6 UTSW 11 29819007 nonsense probably null
R4721:Eml6 UTSW 11 29838525 missense possibly damaging 0.95
R4729:Eml6 UTSW 11 29833204 missense probably damaging 1.00
R4766:Eml6 UTSW 11 29805757 missense probably benign 0.22
R4810:Eml6 UTSW 11 29755011 missense possibly damaging 0.92
R4831:Eml6 UTSW 11 29777052 nonsense probably null
R5035:Eml6 UTSW 11 29854187 missense probably benign 0.00
R5064:Eml6 UTSW 11 29749300 missense probably benign 0.12
R5103:Eml6 UTSW 11 29850905 missense possibly damaging 0.65
R5121:Eml6 UTSW 11 29744606 missense probably benign 0.03
R5211:Eml6 UTSW 11 29854145 missense probably benign 0.02
R5268:Eml6 UTSW 11 29803108 missense probably benign 0.15
R5390:Eml6 UTSW 11 29760096 missense probably damaging 1.00
R5529:Eml6 UTSW 11 29764126 missense probably benign 0.04
R6239:Eml6 UTSW 11 29749275 missense probably damaging 1.00
R6326:Eml6 UTSW 11 29819066 missense probably damaging 1.00
R6395:Eml6 UTSW 11 29809321 missense probably benign 0.00
R6476:Eml6 UTSW 11 29791971 critical splice donor site probably null
R6483:Eml6 UTSW 11 29749875 missense probably benign 0.00
R6701:Eml6 UTSW 11 29785748 missense probably damaging 0.98
R6753:Eml6 UTSW 11 29754987 missense probably damaging 1.00
R6809:Eml6 UTSW 11 29803161 missense probably benign 0.23
R6847:Eml6 UTSW 11 29818447 missense probably benign 0.00
R6855:Eml6 UTSW 11 29751381 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATTCCCTAAGGTTCTTGGACATG -3'
(R):5'- TGATTTTAAAGGCCGGGTGAC -3'

Sequencing Primer
(F):5'- TAAGGTTCTTGGACATGACCCCG -3'
(R):5'- TGTACCCTGAGCCCTTGCAG -3'
Posted On2016-06-21