Incidental Mutation 'R5161:H2afy'
ID397014
Institutional Source Beutler Lab
Gene Symbol H2afy
Ensembl Gene ENSMUSG00000015937
Gene NameH2A histone family, member Y
SynonymsH2AF12M, mH2a1, MACROH2A1.2, macroH2A1
MMRRC Submission 042743-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5161 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location56073619-56136361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56089781 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 222 (D222G)
Ref Sequence ENSEMBL: ENSMUSP00000016081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016081] [ENSMUST00000045788]
Predicted Effect probably benign
Transcript: ENSMUST00000016081
AA Change: D222G

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000016081
Gene: ENSMUSG00000015937
AA Change: D222G

DomainStartEndE-ValueType
H2A 1 120 3.52e-72 SMART
low complexity region 130 163 N/A INTRINSIC
A1pp 196 330 2.72e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000045788
SMART Domains Protein: ENSMUSP00000038221
Gene: ENSMUSG00000015937

DomainStartEndE-ValueType
H2A 1 120 3.52e-72 SMART
low complexity region 130 163 N/A INTRINSIC
A1pp 196 327 4.88e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225993
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent histone that is a member of the histone H2A family. It replaces conventional H2A histones in a subset of nucleosomes where it represses transcription and participates in stable X chromosome inactivation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for one knock-out allele are viable and fertile and display no gross phenotypic abnormalities. Mice homozygous for a different knock-out allele exhibit female-specific hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,001 E27* probably null Het
1700061G19Rik A T 17: 56,882,888 I305F possibly damaging Het
3110035E14Rik G T 1: 9,622,677 G145* probably null Het
4930407I10Rik G T 15: 82,063,341 E480* probably null Het
Acad11 T C 9: 104,124,028 I591T probably benign Het
Adamts13 G A 2: 26,993,008 E857K probably benign Het
Apopt1 C A 12: 111,722,774 Q97K possibly damaging Het
Atf2 A C 2: 73,829,790 probably null Het
Cass4 C A 2: 172,432,324 A675E probably damaging Het
Ctsd A T 7: 142,377,144 L283Q probably damaging Het
Ddrgk1 A T 2: 130,663,376 M1K probably null Het
Dock1 G A 7: 134,734,062 A62T possibly damaging Het
Ehmt1 T C 2: 24,858,195 D407G possibly damaging Het
Eml6 A G 11: 30,024,467 V37A probably damaging Het
Fam20a C T 11: 109,673,370 R519Q probably benign Het
Fam69b C T 2: 26,636,248 T398M possibly damaging Het
Fat1 A G 8: 44,952,512 T767A probably benign Het
Fbxl8 A T 8: 105,268,906 H350L possibly damaging Het
Gm10226 A C 17: 21,691,927 Q23P possibly damaging Het
Gm17677 T A 9: 35,741,588 L42* probably null Het
Gm2075 T A 12: 88,012,117 D90E possibly damaging Het
Gm21994 A T 2: 150,255,215 I98K probably damaging Het
Gm38706 A T 6: 130,482,905 noncoding transcript Het
Gpatch2l G T 12: 86,267,176 R362L probably benign Het
Hyal5 A T 6: 24,891,603 D472V probably benign Het
Ighv5-9-1 T C 12: 113,736,157 S102G possibly damaging Het
Itpripl1 A C 2: 127,141,857 L115R probably damaging Het
Itsn1 G A 16: 91,908,838 C169Y possibly damaging Het
Krt88 T A 15: 101,450,468 C12S probably benign Het
Muc4 G A 16: 32,762,521 V2557M probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nbeal2 G T 9: 110,629,868 Q1996K probably benign Het
Obscn T C 11: 59,028,604 E6205G probably damaging Het
Obscn A G 11: 59,064,310 Y3926H possibly damaging Het
Olfr1436 A T 19: 12,298,789 S114R probably damaging Het
Olfr305 T C 7: 86,364,338 probably null Het
P2ry2 A T 7: 100,998,929 Y56* probably null Het
Pde1a T C 2: 79,878,144 N242S probably null Het
Pik3cg C T 12: 32,204,978 E337K possibly damaging Het
Plxna2 A G 1: 194,751,404 N587S probably benign Het
Pmpca T C 2: 26,395,171 probably null Het
Ptpn4 C T 1: 119,707,863 W370* probably null Het
Qk A T 17: 10,215,490 probably null Het
Rapgef3 A G 15: 97,757,725 V427A probably damaging Het
Rbbp8 T G 18: 11,722,114 D465E probably damaging Het
Scn2a A G 2: 65,764,591 K1928R probably benign Het
Slc5a5 A C 8: 70,888,848 C346G probably damaging Het
Spata2l A G 8: 123,235,549 L91P probably damaging Het
Syt3 C A 7: 44,396,015 H560N possibly damaging Het
Timm23 G A 14: 32,193,925 P63L probably damaging Het
Tmem191c T C 16: 17,276,879 S108P possibly damaging Het
Ttc21b A G 2: 66,229,023 C545R probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp17ld A T 7: 103,250,372 L451* probably null Het
Vmn1r15 T C 6: 57,258,512 Y122H probably benign Het
Other mutations in H2afy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:H2afy APN 13 56074319 missense possibly damaging 0.75
IGL01294:H2afy APN 13 56074300 missense probably damaging 1.00
IGL02505:H2afy APN 13 56074330 missense probably damaging 1.00
IGL02994:H2afy APN 13 56104299 splice site probably benign
R0270:H2afy UTSW 13 56096114 splice site probably benign
R0988:H2afy UTSW 13 56083296 critical splice acceptor site probably null
R1464:H2afy UTSW 13 56083136 missense probably damaging 0.98
R1464:H2afy UTSW 13 56083136 missense probably damaging 0.98
R1638:H2afy UTSW 13 56104909 missense probably damaging 1.00
R1782:H2afy UTSW 13 56074321 missense probably damaging 0.99
R1850:H2afy UTSW 13 56096239 splice site probably benign
R1860:H2afy UTSW 13 56083204 missense probably damaging 1.00
R2228:H2afy UTSW 13 56084262 missense probably damaging 1.00
R4674:H2afy UTSW 13 56083184 missense possibly damaging 0.91
R5102:H2afy UTSW 13 56096123 critical splice donor site probably null
R5106:H2afy UTSW 13 56088293 missense possibly damaging 0.75
R5862:H2afy UTSW 13 56074271 missense probably damaging 1.00
R6165:H2afy UTSW 13 56104455 missense probably damaging 0.97
R6588:H2afy UTSW 13 56104489 missense possibly damaging 0.90
R6994:H2afy UTSW 13 56089830 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GAGTGAGTCAATGCTCAGGG -3'
(R):5'- TGAAGTAGACCCACACTAGCCG -3'

Sequencing Primer
(F):5'- GAGTCAATGCTCAGGGTCTACAATC -3'
(R):5'- GCCCTGTGCACTGCGAG -3'
Posted On2016-06-21