Incidental Mutation 'R5161:Rbbp8'
ID397026
Institutional Source Beutler Lab
Gene Symbol Rbbp8
Ensembl Gene ENSMUSG00000041238
Gene Nameretinoblastoma binding protein 8, endonuclease
Synonyms9930104E21Rik, CtIP
MMRRC Submission 042743-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5161 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location11633276-11743207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 11722114 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 465 (D465E)
Ref Sequence ENSEMBL: ENSMUSP00000111527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047322] [ENSMUST00000115861]
Predicted Effect probably damaging
Transcript: ENSMUST00000047322
AA Change: D465E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046255
Gene: ENSMUSG00000041238
AA Change: D465E

DomainStartEndE-ValueType
Pfam:CtIP_N 20 139 9.6e-61 PFAM
PDB:2L4Z|A 639 675 3e-15 PDB
Pfam:SAE2 790 854 8.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115861
AA Change: D465E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111527
Gene: ENSMUSG00000041238
AA Change: D465E

DomainStartEndE-ValueType
Pfam:CtIP_N 20 139 5.2e-55 PFAM
PDB:2L4Z|A 639 675 3e-15 PDB
Pfam:SAE2 817 854 1.4e-8 PFAM
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It is found among several proteins that bind directly to retinoblastoma protein, which regulates cell proliferation. This protein complexes with transcriptional co-repressor CTBP. It is also associated with BRCA1 and is thought to modulate the functions of BRCA1 in transcriptional regulation, DNA repair, and/or cell cycle checkpoint control. It is suggested that this gene may itself be a tumor suppressor acting in the same pathway as BRCA1. Three transcript variants encoding two different isoforms have been found for this gene. More transcript variants exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele die at E4.0 as blastocysts fail to enter S phase and arrest at G1, leading to elevated cell death. Heterozygous mutant mice display a shortened lifespan due to formation of multiple tumors, mostly large lymphomasof both B and T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,001 E27* probably null Het
1700061G19Rik A T 17: 56,882,888 I305F possibly damaging Het
3110035E14Rik G T 1: 9,622,677 G145* probably null Het
4930407I10Rik G T 15: 82,063,341 E480* probably null Het
Acad11 T C 9: 104,124,028 I591T probably benign Het
Adamts13 G A 2: 26,993,008 E857K probably benign Het
Apopt1 C A 12: 111,722,774 Q97K possibly damaging Het
Atf2 A C 2: 73,829,790 probably null Het
Cass4 C A 2: 172,432,324 A675E probably damaging Het
Ctsd A T 7: 142,377,144 L283Q probably damaging Het
Ddrgk1 A T 2: 130,663,376 M1K probably null Het
Dock1 G A 7: 134,734,062 A62T possibly damaging Het
Ehmt1 T C 2: 24,858,195 D407G possibly damaging Het
Eml6 A G 11: 30,024,467 V37A probably damaging Het
Fam20a C T 11: 109,673,370 R519Q probably benign Het
Fam69b C T 2: 26,636,248 T398M possibly damaging Het
Fat1 A G 8: 44,952,512 T767A probably benign Het
Fbxl8 A T 8: 105,268,906 H350L possibly damaging Het
Gm10226 A C 17: 21,691,927 Q23P possibly damaging Het
Gm17677 T A 9: 35,741,588 L42* probably null Het
Gm2075 T A 12: 88,012,117 D90E possibly damaging Het
Gm21994 A T 2: 150,255,215 I98K probably damaging Het
Gm38706 A T 6: 130,482,905 noncoding transcript Het
Gpatch2l G T 12: 86,267,176 R362L probably benign Het
H2afy T C 13: 56,089,781 D222G probably benign Het
Hyal5 A T 6: 24,891,603 D472V probably benign Het
Ighv5-9-1 T C 12: 113,736,157 S102G possibly damaging Het
Itpripl1 A C 2: 127,141,857 L115R probably damaging Het
Itsn1 G A 16: 91,908,838 C169Y possibly damaging Het
Krt88 T A 15: 101,450,468 C12S probably benign Het
Muc4 G A 16: 32,762,521 V2557M probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nbeal2 G T 9: 110,629,868 Q1996K probably benign Het
Obscn T C 11: 59,028,604 E6205G probably damaging Het
Obscn A G 11: 59,064,310 Y3926H possibly damaging Het
Olfr1436 A T 19: 12,298,789 S114R probably damaging Het
Olfr305 T C 7: 86,364,338 probably null Het
P2ry2 A T 7: 100,998,929 Y56* probably null Het
Pde1a T C 2: 79,878,144 N242S probably null Het
Pik3cg C T 12: 32,204,978 E337K possibly damaging Het
Plxna2 A G 1: 194,751,404 N587S probably benign Het
Pmpca T C 2: 26,395,171 probably null Het
Ptpn4 C T 1: 119,707,863 W370* probably null Het
Qk A T 17: 10,215,490 probably null Het
Rapgef3 A G 15: 97,757,725 V427A probably damaging Het
Scn2a A G 2: 65,764,591 K1928R probably benign Het
Slc5a5 A C 8: 70,888,848 C346G probably damaging Het
Spata2l A G 8: 123,235,549 L91P probably damaging Het
Syt3 C A 7: 44,396,015 H560N possibly damaging Het
Timm23 G A 14: 32,193,925 P63L probably damaging Het
Tmem191c T C 16: 17,276,879 S108P possibly damaging Het
Ttc21b A G 2: 66,229,023 C545R probably damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Usp17ld A T 7: 103,250,372 L451* probably null Het
Vmn1r15 T C 6: 57,258,512 Y122H probably benign Het
Other mutations in Rbbp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Rbbp8 APN 18 11722607 missense probably benign
IGL01302:Rbbp8 APN 18 11721979 missense probably benign
IGL01965:Rbbp8 APN 18 11722260 missense probably benign 0.04
IGL02076:Rbbp8 APN 18 11705819 missense probably damaging 1.00
IGL02410:Rbbp8 APN 18 11732212 missense probably damaging 1.00
IGL02823:Rbbp8 APN 18 11732213 missense possibly damaging 0.89
IGL02859:Rbbp8 APN 18 11738614 missense probably benign 0.42
IGL02966:Rbbp8 APN 18 11705812 missense possibly damaging 0.88
IGL03022:Rbbp8 APN 18 11725502 splice site probably benign
IGL03274:Rbbp8 APN 18 11741076 splice site probably benign
IGL03367:Rbbp8 APN 18 11721719 missense probably benign 0.08
R0063:Rbbp8 UTSW 18 11734557 splice site probably benign
R0063:Rbbp8 UTSW 18 11734557 splice site probably benign
R0167:Rbbp8 UTSW 18 11660922 nonsense probably null
R0314:Rbbp8 UTSW 18 11715818 missense probably benign 0.17
R0864:Rbbp8 UTSW 18 11732184 splice site probably benign
R1033:Rbbp8 UTSW 18 11742705 missense probably benign 0.41
R1678:Rbbp8 UTSW 18 11732315 missense probably benign 0.05
R1964:Rbbp8 UTSW 18 11742679 missense possibly damaging 0.62
R2002:Rbbp8 UTSW 18 11727166 splice site probably benign
R2015:Rbbp8 UTSW 18 11720624 missense probably benign 0.01
R2240:Rbbp8 UTSW 18 11677669 missense probably damaging 0.99
R2308:Rbbp8 UTSW 18 11696776 missense possibly damaging 0.95
R3946:Rbbp8 UTSW 18 11718868 missense probably benign
R4375:Rbbp8 UTSW 18 11725410 missense probably benign 0.00
R4590:Rbbp8 UTSW 18 11732265 nonsense probably null
R4695:Rbbp8 UTSW 18 11721782 nonsense probably null
R4769:Rbbp8 UTSW 18 11722670 missense probably damaging 1.00
R5195:Rbbp8 UTSW 18 11722151 missense probably benign 0.00
R5223:Rbbp8 UTSW 18 11721690 missense probably benign 0.19
R5573:Rbbp8 UTSW 18 11722607 missense probably benign
R5671:Rbbp8 UTSW 18 11742642 missense probably benign 0.00
R6051:Rbbp8 UTSW 18 11738607 missense probably benign 0.17
R6995:Rbbp8 UTSW 18 11718908 missense probably damaging 1.00
R7048:Rbbp8 UTSW 18 11732220 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGTCAGAAGTGAAGGTCATTAGCC -3'
(R):5'- AGCCTCGTAAATAGTGGCTTG -3'

Sequencing Primer
(F):5'- GTGAAGGTCATTAGCCAGTCATTTTC -3'
(R):5'- CCTCGTAAATAGTGGCTTGCTTAAG -3'
Posted On2016-06-21