Incidental Mutation 'R5162:Mdh2'
ID397044
Institutional Source Beutler Lab
Gene Symbol Mdh2
Ensembl Gene ENSMUSG00000019179
Gene Namemalate dehydrogenase 2, NAD (mitochondrial)
SynonymsMor-1, Mor1, Mdh-2
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location135778480-135790398 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 135783475 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019323] [ENSMUST00000138101] [ENSMUST00000196285] [ENSMUST00000196285] [ENSMUST00000200556] [ENSMUST00000200556]
Predicted Effect probably null
Transcript: ENSMUST00000019323
SMART Domains Protein: ENSMUSP00000019323
Gene: ENSMUSG00000019179

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Ldh_1_N 25 168 7.2e-50 PFAM
Pfam:Ldh_1_C 170 334 4.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130795
Predicted Effect probably benign
Transcript: ENSMUST00000138101
SMART Domains Protein: ENSMUSP00000136225
Gene: ENSMUSG00000019179

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143747
Predicted Effect probably null
Transcript: ENSMUST00000196285
SMART Domains Protein: ENSMUSP00000143748
Gene: ENSMUSG00000019179

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Ldh_1_N 25 79 9.5e-14 PFAM
Pfam:Ldh_1_N 74 140 8.2e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000196285
SMART Domains Protein: ENSMUSP00000143748
Gene: ENSMUSG00000019179

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Ldh_1_N 25 79 9.5e-14 PFAM
Pfam:Ldh_1_N 74 140 8.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197909
Predicted Effect probably null
Transcript: ENSMUST00000200556
SMART Domains Protein: ENSMUSP00000142993
Gene: ENSMUSG00000019179

DomainStartEndE-ValueType
Pfam:Ldh_1_N 9 145 1.7e-39 PFAM
Pfam:Ldh_1_C 147 198 3.8e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000200556
SMART Domains Protein: ENSMUSP00000142993
Gene: ENSMUSG00000019179

DomainStartEndE-ValueType
Pfam:Ldh_1_N 9 145 1.7e-39 PFAM
Pfam:Ldh_1_C 147 198 3.8e-13 PFAM
Meta Mutation Damage Score 0.576 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Malate dehydrogenase catalyzes the reversible oxidation of malate to oxaloacetate, utilizing the NAD/NADH cofactor system in the citric acid cycle. The protein encoded by this gene is localized to the mitochondria and may play pivotal roles in the malate-aspartate shuttle that operates in the metabolic coordination between cytosol and mitochondria. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Mdh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mdh2 APN 5 135786284 missense probably damaging 1.00
IGL01413:Mdh2 APN 5 135786025 missense probably damaging 0.99
IGL01418:Mdh2 APN 5 135786025 missense probably damaging 0.99
IGL03290:Mdh2 APN 5 135789713 missense probably damaging 1.00
R0396:Mdh2 UTSW 5 135789679 missense probably benign
R0492:Mdh2 UTSW 5 135790150 missense possibly damaging 0.54
R4977:Mdh2 UTSW 5 135783409 missense probably damaging 1.00
R5839:Mdh2 UTSW 5 135783292 splice site probably null
R6821:Mdh2 UTSW 5 135789671 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ATTTCGTCATCTTAGAGCCCCG -3'
(R):5'- ACAGCTTAGGTATTTGTAGACCCAAG -3'

Sequencing Primer
(F):5'- ATCTTAGAGCCCCGTGCCATG -3'
(R):5'- GTCTAAAACAATGCAGTCATCTGGG -3'
Posted On2016-06-21