Incidental Mutation 'R5162:Olfr459'
ID397048
Institutional Source Beutler Lab
Gene Symbol Olfr459
Ensembl Gene ENSMUSG00000045479
Gene Nameolfactory receptor 459
SynonymsGA_x6K02T2P3E9-5780974-5781915, MOR120-1
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41768770-41775177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 41771772 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 176 (H176N)
Ref Sequence ENSEMBL: ENSMUSP00000149928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050412] [ENSMUST00000214752] [ENSMUST00000214976]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050412
AA Change: H176N

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000061622
Gene: ENSMUSG00000045479
AA Change: H176N

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 7.9e-46 PFAM
Pfam:7TM_GPCR_Srsx 34 304 1.7e-6 PFAM
Pfam:7tm_1 40 290 6.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203430
AA Change: H176N
SMART Domains Protein: ENSMUSP00000145036
Gene: ENSMUSG00000045479
AA Change: H176N

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 7.9e-46 PFAM
Pfam:7TM_GPCR_Srsx 34 304 1.7e-6 PFAM
Pfam:7tm_1 40 290 6.2e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214752
AA Change: H176N

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214976
AA Change: H176N

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Olfr459
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Olfr459 APN 6 41772113 missense probably damaging 1.00
IGL01460:Olfr459 APN 6 41772282 missense probably benign 0.12
IGL02465:Olfr459 APN 6 41771556 missense probably damaging 1.00
R0352:Olfr459 UTSW 6 41772124 missense probably damaging 0.99
R0443:Olfr459 UTSW 6 41771895 missense possibly damaging 0.75
R0480:Olfr459 UTSW 6 41772264 missense probably benign 0.01
R1491:Olfr459 UTSW 6 41771522 missense possibly damaging 0.95
R1495:Olfr459 UTSW 6 41771903 missense probably damaging 1.00
R2103:Olfr459 UTSW 6 41772005 missense probably benign 0.36
R3688:Olfr459 UTSW 6 41772226 nonsense probably null
R3910:Olfr459 UTSW 6 41772149 missense probably benign 0.00
R4709:Olfr459 UTSW 6 41771508 missense probably benign 0.06
R4710:Olfr459 UTSW 6 41771508 missense probably benign 0.06
R4960:Olfr459 UTSW 6 41772069 missense probably damaging 0.97
R5236:Olfr459 UTSW 6 41772111 missense probably benign 0.00
R5441:Olfr459 UTSW 6 41771848 missense probably benign 0.00
R7171:Olfr459 UTSW 6 41772027 missense probably benign 0.09
R7400:Olfr459 UTSW 6 41771744 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGGTGGAGAAGGCTTTC -3'
(R):5'- AGGGACCACAGAGTTTGCAG -3'

Sequencing Primer
(F):5'- GCTTTCTTCCGGCCAGAAG -3'
(R):5'- ACCACAGAGTTTGCAGTGCTTG -3'
Posted On2016-06-21