Incidental Mutation 'R5162:Esrp2'
ID397060
Institutional Source Beutler Lab
Gene Symbol Esrp2
Ensembl Gene ENSMUSG00000084128
Gene Nameepithelial splicing regulatory protein 2
Synonyms9530027K23Rik, Rbm35b
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location106130319-106136974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106133298 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 336 (E336G)
Ref Sequence ENSEMBL: ENSMUSP00000123114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109308] [ENSMUST00000115979] [ENSMUST00000146940] [ENSMUST00000211991]
Predicted Effect probably benign
Transcript: ENSMUST00000109308
SMART Domains Protein: ENSMUSP00000104931
Gene: ENSMUSG00000031902

DomainStartEndE-ValueType
low complexity region 153 182 N/A INTRINSIC
low complexity region 205 225 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
Pfam:RHD_DNA_bind 434 593 4.9e-25 PFAM
IPT 600 699 1.19e-20 SMART
low complexity region 713 722 N/A INTRINSIC
low complexity region 917 938 N/A INTRINSIC
low complexity region 954 967 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115979
AA Change: E337G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111639
Gene: ENSMUSG00000084128
AA Change: E337G

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
RRM 248 320 2.58e-1 SMART
RRM 349 424 2.67e-2 SMART
low complexity region 439 459 N/A INTRINSIC
RRM 466 541 4.17e-3 SMART
low complexity region 549 575 N/A INTRINSIC
low complexity region 593 614 N/A INTRINSIC
low complexity region 644 660 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145343
Predicted Effect probably damaging
Transcript: ENSMUST00000146940
AA Change: E336G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123114
Gene: ENSMUSG00000084128
AA Change: E336G

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
RRM 247 319 2.58e-1 SMART
RRM 348 423 2.67e-2 SMART
low complexity region 438 458 N/A INTRINSIC
RRM 465 540 4.17e-3 SMART
low complexity region 548 574 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155164
Predicted Effect probably benign
Transcript: ENSMUST00000211991
Meta Mutation Damage Score 0.0332 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ESPR2 is an epithelial cell-type-specific splicing regulator (Warzecha et al., 2009 [PubMed 19285943]).[supplied by OMIM, Aug 2009]
PHENOTYPE: Homozygous null mice exhibit defects in hepatic maturation, and decreased serum albumin levels and total serum protein levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Esrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Esrp2 APN 8 106132233 missense probably benign 0.00
R0419:Esrp2 UTSW 8 106134675 missense probably damaging 1.00
R1468:Esrp2 UTSW 8 106133821 missense probably damaging 1.00
R1468:Esrp2 UTSW 8 106133821 missense probably damaging 1.00
R1528:Esrp2 UTSW 8 106136752 missense unknown
R1598:Esrp2 UTSW 8 106133273 missense probably damaging 0.97
R1817:Esrp2 UTSW 8 106134618 missense probably damaging 1.00
R1885:Esrp2 UTSW 8 106131821 missense possibly damaging 0.80
R1886:Esrp2 UTSW 8 106133857 missense probably damaging 1.00
R2323:Esrp2 UTSW 8 106134302 missense probably benign 0.27
R3761:Esrp2 UTSW 8 106133622 missense probably damaging 1.00
R4598:Esrp2 UTSW 8 106132711 missense probably damaging 1.00
R4792:Esrp2 UTSW 8 106132509 missense probably damaging 1.00
R5091:Esrp2 UTSW 8 106132429 missense probably damaging 1.00
R5114:Esrp2 UTSW 8 106132188 missense probably benign 0.42
R5678:Esrp2 UTSW 8 106132118 missense probably damaging 0.97
R5947:Esrp2 UTSW 8 106132933 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCAAAGGCATCCCCAGTAG -3'
(R):5'- CTGAGACCTATGGGCTGGTTTC -3'

Sequencing Primer
(F):5'- CAGTAGGCCTGCCATCAG -3'
(R):5'- CCTGCAGGTATATAAAGCCACAGG -3'
Posted On2016-06-21