Incidental Mutation 'R5162:Cry1'
ID397065
Institutional Source Beutler Lab
Gene Symbol Cry1
Ensembl Gene ENSMUSG00000020038
Gene Namecryptochrome 1 (photolyase-like)
SynonymsPhll1
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location85131700-85185064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85133286 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 558 (H558L)
Ref Sequence ENSEMBL: ENSMUSP00000020227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020227]
PDB Structure
Crystal Structure of Mouse Cryptochrome1 in Complex with Period2 [X-RAY DIFFRACTION]
Crystal structure of mouse Cryptochrome 1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020227
AA Change: H558L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020227
Gene: ENSMUSG00000020038
AA Change: H558L

DomainStartEndE-ValueType
Pfam:DNA_photolyase 5 168 1.4e-47 PFAM
Pfam:FAD_binding_7 213 486 6.9e-91 PFAM
internal_repeat_1 502 523 3.57e-8 PROSPERO
internal_repeat_1 521 543 3.57e-8 PROSPERO
low complexity region 544 555 N/A INTRINSIC
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. Loss of this gene results in a shortened circadian cycle in complete darkness. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a one-hour shorter circadian period under constant darkness and reduced expression of another circadian gene in the suprachiasmatic nucleus in response to acute light exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Cry1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Cry1 APN 10 85146834 missense probably benign 0.11
IGL00737:Cry1 APN 10 85143040 missense probably benign 0.02
IGL01349:Cry1 APN 10 85148739 missense probably benign 0.00
IGL01544:Cry1 APN 10 85146496 nonsense probably null
IGL01545:Cry1 APN 10 85184362 missense possibly damaging 0.94
IGL01767:Cry1 APN 10 85146474 missense probably damaging 1.00
IGL03392:Cry1 APN 10 85157129 missense possibly damaging 0.88
R0119:Cry1 UTSW 10 85133240 critical splice donor site probably null
R0605:Cry1 UTSW 10 85184359 missense probably damaging 0.96
R1618:Cry1 UTSW 10 85146454 missense probably damaging 1.00
R1955:Cry1 UTSW 10 85144178 missense probably benign 0.00
R2209:Cry1 UTSW 10 85146755 missense probably damaging 0.98
R2221:Cry1 UTSW 10 85143753 missense probably damaging 1.00
R2223:Cry1 UTSW 10 85143753 missense probably damaging 1.00
R2314:Cry1 UTSW 10 85133311 missense probably benign 0.08
R3851:Cry1 UTSW 10 85146499 missense probably benign 0.15
R3872:Cry1 UTSW 10 85133160 critical splice acceptor site probably null
R3981:Cry1 UTSW 10 85146592 missense probably damaging 0.99
R4856:Cry1 UTSW 10 85148770 missense probably damaging 0.97
R5404:Cry1 UTSW 10 85184419 missense probably damaging 1.00
R5449:Cry1 UTSW 10 85133135 missense probably benign 0.17
R5484:Cry1 UTSW 10 85146724 unclassified probably null
R5599:Cry1 UTSW 10 85144250 missense probably benign 0.14
R5717:Cry1 UTSW 10 85146416 missense probably damaging 1.00
R7031:Cry1 UTSW 10 85148662 missense probably benign 0.00
R7371:Cry1 UTSW 10 85147919 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TAGGACGCTTCCCACTGCTG -3'
(R):5'- TACATGTAAACACTGCACTCAAAGT -3'

Sequencing Primer
(F):5'- TTCCCACTGCTGAGGCC -3'
(R):5'- AGACAACCAGTGCTTTATTTTTGCC -3'
Posted On2016-06-21