Incidental Mutation 'R5162:Fn3krp'
ID397068
Institutional Source Beutler Lab
Gene Symbol Fn3krp
Ensembl Gene ENSMUSG00000039253
Gene Namefructosamine 3 kinase related protein
Synonyms
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location121421401-121431288 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121429584 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 252 (F252L)
Ref Sequence ENSEMBL: ENSMUSP00000038061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038096]
Predicted Effect probably damaging
Transcript: ENSMUST00000038096
AA Change: F252L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038061
Gene: ENSMUSG00000039253
AA Change: F252L

DomainStartEndE-ValueType
Pfam:Fructosamin_kin 1 309 6e-81 PFAM
Pfam:APH 22 267 1.5e-12 PFAM
Meta Mutation Damage Score 0.512 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A high concentration of glucose can result in non-enzymatic oxidation of proteins by reaction of glucose and lysine residues (glycation). Proteins modified in this way are less active or functional. This gene encodes an enzyme which catalyzes the phosphorylation of psicosamines and ribulosamines compared to the neighboring gene which encodes a highly similar enzyme, fructosamine-3-kinase, which has different substrate specificity. The activity of both enzymes may result in deglycation of proteins to restore their function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Fn3krp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Fn3krp APN 11 121421554 missense probably damaging 1.00
IGL01633:Fn3krp APN 11 121429707 nonsense probably null
IGL02123:Fn3krp APN 11 121429444 missense probably benign 0.00
IGL03189:Fn3krp APN 11 121429630 missense probably damaging 1.00
R0278:Fn3krp UTSW 11 121421580 missense probably damaging 1.00
R1927:Fn3krp UTSW 11 121424977 missense probably damaging 0.99
R3744:Fn3krp UTSW 11 121426705 critical splice donor site probably null
R4471:Fn3krp UTSW 11 121426673 missense probably benign 0.01
R4850:Fn3krp UTSW 11 121425053 missense possibly damaging 0.56
R5027:Fn3krp UTSW 11 121429448 missense probably benign 0.01
R5444:Fn3krp UTSW 11 121421604 critical splice donor site probably null
R6230:Fn3krp UTSW 11 121425592 missense probably damaging 1.00
R7183:Fn3krp UTSW 11 121421605 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTACACCTCCGTATGGTTGGC -3'
(R):5'- AGCCAGTTCATTTGCTGAGATTC -3'

Sequencing Primer
(F):5'- GGCCACTTTGTTTAAGGCTC -3'
(R):5'- CCTCATTATGTTTAGAGAGGATCCC -3'
Posted On2016-06-21