Incidental Mutation 'R5162:Naip5'
ID397071
Institutional Source Beutler Lab
Gene Symbol Naip5
Ensembl Gene ENSMUSG00000071203
Gene NameNLR family, apoptosis inhibitory protein 5
SynonymsBirc1e, Lgn1, Naip-rs3
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location100211739-100246323 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100223406 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 441 (I441F)
Ref Sequence ENSEMBL: ENSMUSP00000058611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049789]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049789
AA Change: I441F

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: I441F

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.08e-19 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 2.14e-32 SMART
Pfam:NACHT 464 618 1.7e-36 PFAM
low complexity region 851 862 N/A INTRINSIC
Meta Mutation Damage Score 0.0504 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Naip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Naip5 APN 13 100246175 nonsense probably null
IGL00493:Naip5 APN 13 100230771 missense probably damaging 0.96
IGL01294:Naip5 APN 13 100217080 missense probably damaging 0.99
IGL01405:Naip5 APN 13 100221945 missense probably benign 0.11
IGL01568:Naip5 APN 13 100217101 missense probably benign 0.26
IGL01804:Naip5 APN 13 100221584 missense probably damaging 1.00
IGL02012:Naip5 APN 13 100223339 missense probably benign 0.01
IGL02183:Naip5 APN 13 100221642 missense probably benign 0.41
IGL02449:Naip5 APN 13 100222175 missense probably benign 0.34
IGL02815:Naip5 APN 13 100222731 missense probably benign
IGL02992:Naip5 APN 13 100223028 missense probably damaging 1.00
IGL03027:Naip5 APN 13 100223016 missense probably benign 0.00
IGL03234:Naip5 APN 13 100212627 missense probably damaging 1.00
inwood2 UTSW 13 100223014 nonsense probably null
inwood3 UTSW 13 100221903 nonsense probably null
PIT4131001:Naip5 UTSW 13 100219739 missense probably benign
PIT4131001:Naip5 UTSW 13 100219760 missense probably benign 0.00
R0001:Naip5 UTSW 13 100214650 critical splice donor site probably null
R0001:Naip5 UTSW 13 100223114 missense probably benign
R0462:Naip5 UTSW 13 100221732 missense probably damaging 1.00
R0636:Naip5 UTSW 13 100219688 missense probably benign
R0674:Naip5 UTSW 13 100223199 missense probably benign 0.04
R0764:Naip5 UTSW 13 100217105 missense probably benign 0.03
R0837:Naip5 UTSW 13 100230743 missense probably benign
R1179:Naip5 UTSW 13 100219830 missense probably benign
R1302:Naip5 UTSW 13 100221591 missense possibly damaging 0.91
R1441:Naip5 UTSW 13 100219717 missense possibly damaging 0.95
R1513:Naip5 UTSW 13 100222206 missense probably benign
R1638:Naip5 UTSW 13 100212669 missense probably damaging 1.00
R1651:Naip5 UTSW 13 100221911 missense probably benign 0.41
R1707:Naip5 UTSW 13 100242855 missense probably damaging 1.00
R1835:Naip5 UTSW 13 100223218 nonsense probably null
R1836:Naip5 UTSW 13 100219687 missense probably benign 0.18
R1972:Naip5 UTSW 13 100212770 missense probably damaging 0.98
R2080:Naip5 UTSW 13 100221533 missense probably damaging 1.00
R2333:Naip5 UTSW 13 100223171 missense probably damaging 1.00
R2348:Naip5 UTSW 13 100219738 missense probably benign 0.01
R3055:Naip5 UTSW 13 100221878 missense probably benign 0.23
R3401:Naip5 UTSW 13 100221903 nonsense probably null
R3723:Naip5 UTSW 13 100223014 nonsense probably null
R3775:Naip5 UTSW 13 100223375 missense probably benign 0.00
R3775:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4074:Naip5 UTSW 13 100246064 missense probably damaging 1.00
R4082:Naip5 UTSW 13 100245830 missense probably damaging 1.00
R4105:Naip5 UTSW 13 100219739 missense probably benign
R4227:Naip5 UTSW 13 100212768 missense probably damaging 0.99
R4639:Naip5 UTSW 13 100219830 missense probably benign
R4640:Naip5 UTSW 13 100219830 missense probably benign
R4641:Naip5 UTSW 13 100219830 missense probably benign
R4644:Naip5 UTSW 13 100219830 missense probably benign
R4645:Naip5 UTSW 13 100219830 missense probably benign
R4700:Naip5 UTSW 13 100223414 missense possibly damaging 0.62
R4727:Naip5 UTSW 13 100221870 missense possibly damaging 0.81
R4729:Naip5 UTSW 13 100222131 missense possibly damaging 0.75
R4816:Naip5 UTSW 13 100219681 missense probably benign 0.32
R4816:Naip5 UTSW 13 100219687 missense probably benign 0.01
R4816:Naip5 UTSW 13 100219696 missense probably benign 0.00
R4869:Naip5 UTSW 13 100245131 missense probably damaging 1.00
R5244:Naip5 UTSW 13 100245662 missense probably benign 0.08
R5411:Naip5 UTSW 13 100245746 missense possibly damaging 0.54
R5632:Naip5 UTSW 13 100230662 splice site probably null
R5760:Naip5 UTSW 13 100242838 missense probably damaging 1.00
R5916:Naip5 UTSW 13 100222701 missense probably benign 0.02
R6302:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6304:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6411:Naip5 UTSW 13 100223405 missense probably benign 0.01
R6474:Naip5 UTSW 13 100214663 missense possibly damaging 0.82
R6499:Naip5 UTSW 13 100221594 missense probably benign
R6544:Naip5 UTSW 13 100223144 missense possibly damaging 0.50
R6827:Naip5 UTSW 13 100245929 missense possibly damaging 0.48
R6954:Naip5 UTSW 13 100223414 missense probably damaging 0.99
R7052:Naip5 UTSW 13 100222347 missense probably benign 0.01
R7138:Naip5 UTSW 13 100219830 missense probably benign
R7141:Naip5 UTSW 13 100219830 missense probably benign
R7375:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7375:Naip5 UTSW 13 100219697 missense not run
R7401:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7401:Naip5 UTSW 13 100219697 missense not run
R7447:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7447:Naip5 UTSW 13 100219697 missense not run
R7466:Naip5 UTSW 13 100221986 nonsense probably null
R7491:Naip5 UTSW 13 100217071 missense probably benign 0.18
R7559:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7559:Naip5 UTSW 13 100219697 missense not run
R7562:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7562:Naip5 UTSW 13 100219697 missense not run
Predicted Primers PCR Primer
(F):5'- ATGTTGGCCAGTCCCTGATC -3'
(R):5'- TCTCTCCACAGACTTGGGTAG -3'

Sequencing Primer
(F):5'- CCCTGATCTGGTGTGATGGAACTAAG -3'
(R):5'- CTCCACAGACTTGGGTAGGAGTG -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.
 

PCR Primers

R51620049_PCR_F: 5’- ATGTTGGCCAGTCCCTGATC-3’

R51620049_PCR_R: 5’- TCTCTCCACAGACTTGGGTAG-3’

 

Sequencing Primers

R51620049_SEQ_F: 5’- CCCTGATCTGGTGTGATGGAACTAAG-3’
 

R51620049_SEQ_R: 5’- CTCCACAGACTTGGGTAGGAGTG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 402 nucleotides is amplified (Chr13: 100223174-100427504):

 

27301 agctgccaga gaggttcgaa gtgtaccacc ctatacctcc ctgtacctcc cttctctcca    

27361 cagacttggg taggagtgaa gcccagtggt ttcaagaggc caggagtctg agtgagcagc    

27421 taagagacaa ctacactaaa gccactttcc gccacatgaa cttgccagaa gtgtgctcca    

27481 gccttggcac tgaccacttg ctcagctgcg atgtgtccat catttcaaag cacatcagcc    

27541 agcctgtgca agaggccctg acgatccccg aggtcttctc caatctcaac tctgtcatgt    

27601 gtgtggaggg ggaaactggc agtggaaaga caaccttcct gaagaggata gcttttctct    

27661 gggcatcagg atgctgcccc ctgttgtaca ggttccagct ggtcttctat ctctccctta    

27721 gttccatcac accagatcag ggactggcca acatcatctg tgcccaactc ctaggggcag

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = T>A; sense strand = A>T).

Posted On2016-06-21