Incidental Mutation 'R5162:Trim23'
ID397072
Institutional Source Beutler Lab
Gene Symbol Trim23
Ensembl Gene ENSMUSG00000021712
Gene Nametripartite motif-containing 23
Synonyms6330516O20Rik, Arfd1
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location104178797-104203372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104181174 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 61 (T61I)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022224] [ENSMUST00000022225] [ENSMUST00000069174] [ENSMUST00000069187] [ENSMUST00000141557] [ENSMUST00000144060] [ENSMUST00000179891]
Predicted Effect probably benign
Transcript: ENSMUST00000022224
SMART Domains Protein: ENSMUSP00000022224
Gene: ENSMUSG00000021711

DomainStartEndE-ValueType
Pfam:DUF974 65 298 1.3e-87 PFAM
low complexity region 366 388 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000022225
AA Change: T61I

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022225
Gene: ENSMUSG00000021712
AA Change: T61I

DomainStartEndE-ValueType
RING 31 75 3.07e-5 SMART
BBOX 122 168 3.07e-1 SMART
BBOX 173 219 1.32e-4 SMART
BBC 226 370 2.89e-41 SMART
ARF 387 569 1.15e-78 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000069174
AA Change: T41I

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000069371
Gene: ENSMUSG00000021712
AA Change: T41I

DomainStartEndE-ValueType
RING 11 55 3.07e-5 SMART
BBOX 102 148 3.07e-1 SMART
BBOX 153 199 1.32e-4 SMART
BBC 206 350 2.89e-41 SMART
ARF 367 549 1.15e-78 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000069187
AA Change: T61I

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070767
Gene: ENSMUSG00000021712
AA Change: T61I

DomainStartEndE-ValueType
RING 31 75 3.07e-5 SMART
BBOX 122 168 3.07e-1 SMART
BBOX 173 219 5.95e-3 SMART
BBC 182 309 8.07e-22 SMART
ARF 326 508 1.15e-78 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133280
Predicted Effect probably benign
Transcript: ENSMUST00000141557
SMART Domains Protein: ENSMUSP00000118316
Gene: ENSMUSG00000021711

DomainStartEndE-ValueType
Pfam:DUF974 65 299 1.6e-88 PFAM
low complexity region 365 387 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142745
Predicted Effect probably benign
Transcript: ENSMUST00000144060
SMART Domains Protein: ENSMUSP00000114406
Gene: ENSMUSG00000021711

DomainStartEndE-ValueType
Pfam:DUF974 65 293 4.4e-87 PFAM
low complexity region 360 382 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160230
AA Change: T61I

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124425
Gene: ENSMUSG00000021712
AA Change: T61I

DomainStartEndE-ValueType
RING 31 75 3.07e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179891
SMART Domains Protein: ENSMUSP00000136986
Gene: ENSMUSG00000021711

DomainStartEndE-ValueType
Pfam:DUF974 65 299 1e-87 PFAM
low complexity region 366 388 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein is also a member of the ADP ribosylation factor family of guanine nucleotide-binding family of proteins. Its carboxy terminus contains an ADP-ribosylation factor domain and a guanine nucleotide binding site, while the amino terminus contains a GTPase activating protein domain which acts on the guanine nucleotide binding site. The protein localizes to lysosomes and the Golgi apparatus. It plays a role in the formation of intracellular transport vesicles, their movement from one compartment to another, and phopholipase D activation. Three alternatively spliced transcript variants for this gene have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit mild myopathy with sarcotubular myopathy, decreased fertility, and decreased axon diameter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Trim23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02092:Trim23 APN 13 104187612 missense probably benign 0.30
R0462:Trim23 UTSW 13 104198033 missense probably damaging 1.00
R0638:Trim23 UTSW 13 104201309 missense probably benign 0.00
R0980:Trim23 UTSW 13 104188127 missense probably damaging 1.00
R1087:Trim23 UTSW 13 104188110 missense possibly damaging 0.66
R1764:Trim23 UTSW 13 104198618 missense probably damaging 1.00
R2441:Trim23 UTSW 13 104192075 missense probably damaging 1.00
R4006:Trim23 UTSW 13 104187623 missense probably benign 0.00
R4010:Trim23 UTSW 13 104181018 unclassified probably benign
R5383:Trim23 UTSW 13 104198697 missense probably damaging 1.00
R5389:Trim23 UTSW 13 104192033 missense probably damaging 0.96
R5520:Trim23 UTSW 13 104187527 missense probably damaging 1.00
R5539:Trim23 UTSW 13 104198033 missense probably damaging 1.00
R5557:Trim23 UTSW 13 104187509 missense probably damaging 1.00
R7079:Trim23 UTSW 13 104187293 intron probably null
R7249:Trim23 UTSW 13 104188155 missense probably damaging 0.99
R7290:Trim23 UTSW 13 104187433 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAACATGCCTGGCTTGG -3'
(R):5'- AGAGTGGACCTCATCTACCTTAG -3'

Sequencing Primer
(F):5'- AAACATGCCTGGCTTGGTCAATTG -3'
(R):5'- GAGACTCAGATTGTGAAAGCTCTTTG -3'
Posted On2016-06-21