Incidental Mutation 'R5162:Atp8b1'
ID397081
Institutional Source Beutler Lab
Gene Symbol Atp8b1
Ensembl Gene ENSMUSG00000039529
Gene NameATPase, class I, type 8B, member 1
SynonymsFIC1, Ic
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location64528979-64661000 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64561662 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 516 (I516M)
Ref Sequence ENSEMBL: ENSMUSP00000025482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025482]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025482
AA Change: I516M

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025482
Gene: ENSMUSG00000039529
AA Change: I516M

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 65 144 5.3e-29 PFAM
Pfam:E1-E2_ATPase 146 413 6e-11 PFAM
Pfam:HAD 451 902 2.4e-21 PFAM
Pfam:Cation_ATPase 532 632 1e-12 PFAM
Pfam:PhoLip_ATPase_C 919 1173 7.3e-82 PFAM
low complexity region 1193 1207 N/A INTRINSIC
low complexity region 1221 1232 N/A INTRINSIC
Meta Mutation Damage Score 0.0508 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P-type cation transport ATPase family, which belongs to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Mutations in this gene may result in progressive familial intrahepatic cholestasis type 1 and in benign recurrent intrahepatic cholestasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display abnormal bile salt homeostasis, normal bile secretion, and an impaired ability to handle increased bile salt loading resulting in liver damage and weight loss on a bile salt supplemented diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Atp8b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Atp8b1 APN 18 64564430 missense probably benign 0.23
IGL00907:Atp8b1 APN 18 64561705 missense possibly damaging 0.95
IGL00962:Atp8b1 APN 18 64531444 missense probably damaging 1.00
IGL01433:Atp8b1 APN 18 64573519 missense probably benign 0.00
IGL01525:Atp8b1 APN 18 64539252 nonsense probably null
IGL01645:Atp8b1 APN 18 64546113 missense probably benign 0.06
IGL02008:Atp8b1 APN 18 64538695 splice site probably benign
IGL02227:Atp8b1 APN 18 64562190 missense probably benign
IGL02231:Atp8b1 APN 18 64550384 missense possibly damaging 0.94
IGL02326:Atp8b1 APN 18 64538583 missense probably damaging 0.99
IGL02562:Atp8b1 APN 18 64581986 missense probably benign
IGL02929:Atp8b1 APN 18 64561662 missense possibly damaging 0.63
enchilada UTSW 18 64545989 critical splice donor site probably null
PIT4520001:Atp8b1 UTSW 18 64568180 missense probably benign 0.34
PIT4696001:Atp8b1 UTSW 18 64539270 missense possibly damaging 0.93
R0144:Atp8b1 UTSW 18 64571374 splice site probably benign
R0193:Atp8b1 UTSW 18 64561636 missense probably benign
R0277:Atp8b1 UTSW 18 64568252 missense possibly damaging 0.94
R0308:Atp8b1 UTSW 18 64545244 nonsense probably null
R0323:Atp8b1 UTSW 18 64568252 missense possibly damaging 0.94
R0403:Atp8b1 UTSW 18 64540310 missense probably damaging 1.00
R0601:Atp8b1 UTSW 18 64571653 splice site probably null
R0614:Atp8b1 UTSW 18 64533587 splice site probably benign
R0883:Atp8b1 UTSW 18 64564541 missense probably benign 0.44
R1077:Atp8b1 UTSW 18 64573262 nonsense probably null
R1292:Atp8b1 UTSW 18 64571021 missense probably damaging 0.99
R1494:Atp8b1 UTSW 18 64564526 missense probably damaging 1.00
R1522:Atp8b1 UTSW 18 64550432 missense probably benign 0.00
R1534:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1535:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1536:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1537:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1650:Atp8b1 UTSW 18 64571549 splice site probably benign
R1772:Atp8b1 UTSW 18 64573492 missense possibly damaging 0.88
R2016:Atp8b1 UTSW 18 64540334 missense probably damaging 1.00
R2017:Atp8b1 UTSW 18 64540334 missense probably damaging 1.00
R2043:Atp8b1 UTSW 18 64605200 missense possibly damaging 0.94
R2223:Atp8b1 UTSW 18 64564357 missense possibly damaging 0.88
R3052:Atp8b1 UTSW 18 64553108 missense probably benign 0.04
R3694:Atp8b1 UTSW 18 64533721 missense possibly damaging 0.81
R3738:Atp8b1 UTSW 18 64533729 splice site probably benign
R4211:Atp8b1 UTSW 18 64553047 missense probably damaging 1.00
R4362:Atp8b1 UTSW 18 64564537 missense probably damaging 1.00
R4560:Atp8b1 UTSW 18 64556879 nonsense probably null
R4560:Atp8b1 UTSW 18 64568247 missense probably benign 0.11
R4562:Atp8b1 UTSW 18 64556891 missense probably damaging 1.00
R4615:Atp8b1 UTSW 18 64553099 missense probably null
R4676:Atp8b1 UTSW 18 64538678 missense probably benign 0.01
R4738:Atp8b1 UTSW 18 64545180 missense probably benign 0.31
R4774:Atp8b1 UTSW 18 64533659 missense possibly damaging 0.49
R4808:Atp8b1 UTSW 18 64561711 missense probably benign 0.01
R4868:Atp8b1 UTSW 18 64551866 missense probably damaging 1.00
R5289:Atp8b1 UTSW 18 64546087 missense possibly damaging 0.51
R5328:Atp8b1 UTSW 18 64531391 missense probably benign 0.00
R5400:Atp8b1 UTSW 18 64545989 critical splice donor site probably null
R5587:Atp8b1 UTSW 18 64539210 missense probably damaging 1.00
R5623:Atp8b1 UTSW 18 64546094 missense possibly damaging 0.85
R5651:Atp8b1 UTSW 18 64531382 missense probably benign 0.31
R5652:Atp8b1 UTSW 18 64531382 missense probably benign 0.31
R5653:Atp8b1 UTSW 18 64545197 missense probably damaging 1.00
R5667:Atp8b1 UTSW 18 64581923 missense probably damaging 1.00
R5689:Atp8b1 UTSW 18 64564537 missense probably damaging 1.00
R6008:Atp8b1 UTSW 18 64577616 missense probably damaging 1.00
R6315:Atp8b1 UTSW 18 64531479 missense probably damaging 0.97
R6759:Atp8b1 UTSW 18 64546090 missense probably benign 0.00
R6850:Atp8b1 UTSW 18 64556852 missense possibly damaging 0.94
R7255:Atp8b1 UTSW 18 64556868 missense probably damaging 1.00
X0025:Atp8b1 UTSW 18 64571405 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAATGGCCATTGGTTGAGGG -3'
(R):5'- CCAAAGTTCTAGAGACTGGAATCC -3'

Sequencing Primer
(F):5'- CATTGGTTGAGGGTTTGTGACAAATG -3'
(R):5'- ATGATCCTGGCTTGTAGACACCAG -3'
Posted On2016-06-21