Incidental Mutation 'R5163:Rab22a'
ID397085
Institutional Source Beutler Lab
Gene Symbol Rab22a
Ensembl Gene ENSMUSG00000027519
Gene NameRAB22A, member RAS oncogene family
SynonymsRab22, E130120E14Rik, 3732413A17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5163 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location173659760-173707343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 173661487 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 31 (D31G)
Ref Sequence ENSEMBL: ENSMUSP00000104738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029024] [ENSMUST00000109110] [ENSMUST00000142820]
Predicted Effect probably damaging
Transcript: ENSMUST00000029024
AA Change: D31G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029024
Gene: ENSMUSG00000027519
AA Change: D31G

DomainStartEndE-ValueType
RAB 6 169 1.96e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109110
AA Change: D31G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104738
Gene: ENSMUSG00000027519
AA Change: D31G

DomainStartEndE-ValueType
Pfam:Arf 1 159 2.7e-8 PFAM
Pfam:Miro 7 114 4.3e-14 PFAM
Pfam:Ras 7 161 2e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142320
Predicted Effect probably benign
Transcript: ENSMUST00000142820
AA Change: D31G

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122799
Gene: ENSMUSG00000027519
AA Change: D31G

DomainStartEndE-ValueType
Pfam:Ras 7 61 1.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153162
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RAB family of small GTPases. The GTP-bound form of the encoded protein has been shown to interact with early-endosomal antigen 1, and may be involved in the trafficking of and interaction between endosomal compartments. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Btbd19 T G 4: 117,121,431 I152L probably damaging Het
Ercc6l2 A G 13: 63,899,031 probably benign Het
Fat4 A G 3: 38,980,797 D2866G probably damaging Het
Fkbp10 C T 11: 100,423,099 A311V probably benign Het
Fnbp1l T C 3: 122,544,663 N511S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gltp A G 5: 114,674,061 I147T probably benign Het
Gpr37 A T 6: 25,669,615 I410N possibly damaging Het
Hivep2 G A 10: 14,139,425 G1779R probably damaging Het
Ifna14 T C 4: 88,571,362 Y146C probably damaging Het
Loxhd1 A G 18: 77,361,736 D662G possibly damaging Het
Lrrc6 T C 15: 66,442,218 D311G probably benign Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Map2k3 T A 11: 60,943,491 I95N probably damaging Het
Mark1 A G 1: 184,905,610 I594T probably damaging Het
Mettl14 T C 3: 123,374,825 I189V possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Odf4 C A 11: 68,922,846 C133F probably damaging Het
Olfr976 T C 9: 39,956,920 N5S probably damaging Het
Opa1 A T 16: 29,597,620 Q106L probably damaging Het
Pax4 T G 6: 28,446,270 S75R probably damaging Het
Ppfibp1 T A 6: 147,022,131 probably null Het
Ptpn20 T C 14: 33,631,111 I269T probably benign Het
Ptprq T C 10: 107,524,331 Q2161R probably damaging Het
Rap1gds1 A T 3: 138,959,056 M296K probably damaging Het
Rfx1 A G 8: 84,093,211 T692A probably damaging Het
Sf3b2 A G 19: 5,275,137 V769A probably damaging Het
Skint5 A T 4: 113,795,565 F621I unknown Het
Spink5 A C 18: 43,999,857 R513S possibly damaging Het
Srrm2 C T 17: 23,819,550 probably benign Het
Srrt A G 5: 137,296,773 probably null Het
Sun3 T C 11: 9,023,295 Q134R possibly damaging Het
Tpo A G 12: 30,105,980 V174A probably benign Het
Ucp1 A G 8: 83,294,203 R183G possibly damaging Het
Vmn2r66 A G 7: 85,006,809 V333A probably benign Het
Wdr60 C T 12: 116,255,866 R152H possibly damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp936 A G 7: 43,190,240 Q377R probably damaging Het
Zkscan2 T C 7: 123,499,867 E34G probably benign Het
Zufsp T A 10: 33,949,443 E14D probably damaging Het
Other mutations in Rab22a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Rab22a APN 2 173688210 missense probably damaging 1.00
IGL01889:Rab22a APN 2 173688238 intron probably benign
IGL03113:Rab22a APN 2 173661472 missense probably damaging 1.00
PIT1430001:Rab22a UTSW 2 173695170 missense probably benign 0.09
R0304:Rab22a UTSW 2 173661459 missense probably damaging 1.00
R1937:Rab22a UTSW 2 173688211 missense probably damaging 1.00
R2914:Rab22a UTSW 2 173695281 missense probably benign 0.00
R4473:Rab22a UTSW 2 173695263 missense probably damaging 1.00
R4474:Rab22a UTSW 2 173695263 missense probably damaging 1.00
R4476:Rab22a UTSW 2 173695263 missense probably damaging 1.00
R4559:Rab22a UTSW 2 173661433 missense probably damaging 1.00
R5934:Rab22a UTSW 2 173661504 missense probably damaging 1.00
R6753:Rab22a UTSW 2 173701055 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGGCCCCGTAATATAGTTACTTC -3'
(R):5'- AATCATTTTGGGAATGTCAAGACCC -3'

Sequencing Primer
(F):5'- CTTCACTGACTTATTACAGAAGCCTG -3'
(R):5'- GGGAATGTCAAGACCCAGCAATTC -3'
Posted On2016-06-21