Incidental Mutation 'R5163:Rap1gds1'
ID397089
Institutional Source Beutler Lab
Gene Symbol Rap1gds1
Ensembl Gene ENSMUSG00000028149
Gene NameRAP1, GTP-GDP dissociation stimulator 1
SynonymsGDS1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.661) question?
Stock #R5163 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location138925902-139075201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 138959056 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 296 (M296K)
Ref Sequence ENSEMBL: ENSMUSP00000096173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029796] [ENSMUST00000098574] [ENSMUST00000196106] [ENSMUST00000196280] [ENSMUST00000200396]
Predicted Effect probably damaging
Transcript: ENSMUST00000029796
AA Change: M247K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029796
Gene: ENSMUSG00000028149
AA Change: M247K

DomainStartEndE-ValueType
ARM 77 118 1.36e-6 SMART
ARM 119 162 7.98e-4 SMART
ARM 297 341 2.4e-7 SMART
ARM 342 382 6.3e1 SMART
ARM 430 470 6.39e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098574
AA Change: M296K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096173
Gene: ENSMUSG00000028149
AA Change: M296K

DomainStartEndE-ValueType
ARM 77 118 1.36e-6 SMART
ARM 169 211 1.74e-4 SMART
ARM 346 390 2.4e-7 SMART
ARM 391 431 6.3e1 SMART
ARM 479 519 6.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196106
Predicted Effect probably benign
Transcript: ENSMUST00000196280
AA Change: M296K

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000143181
Gene: ENSMUSG00000028149
AA Change: M296K

DomainStartEndE-ValueType
ARM 77 118 1.36e-6 SMART
ARM 169 211 1.74e-4 SMART
ARM 346 390 2.4e-7 SMART
ARM 391 431 6.3e1 SMART
ARM 478 518 6.39e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200262
Predicted Effect probably damaging
Transcript: ENSMUST00000200396
AA Change: M247K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143517
Gene: ENSMUSG00000028149
AA Change: M247K

DomainStartEndE-ValueType
ARM 77 118 6.7e-9 SMART
ARM 119 162 3.9e-6 SMART
ARM 297 341 1.2e-9 SMART
ARM 342 382 3.1e-1 SMART
ARM 430 470 3.1e-5 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The smg GDP dissociation stimulator (smgGDS) protein is a stimulatory GDP/GTP exchange protein with GTPase activity (Riess et al., 1993 [PubMed 8262526]).[supplied by OMIM, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Btbd19 T G 4: 117,121,431 I152L probably damaging Het
Ercc6l2 A G 13: 63,899,031 probably benign Het
Fat4 A G 3: 38,980,797 D2866G probably damaging Het
Fkbp10 C T 11: 100,423,099 A311V probably benign Het
Fnbp1l T C 3: 122,544,663 N511S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gltp A G 5: 114,674,061 I147T probably benign Het
Gpr37 A T 6: 25,669,615 I410N possibly damaging Het
Hivep2 G A 10: 14,139,425 G1779R probably damaging Het
Ifna14 T C 4: 88,571,362 Y146C probably damaging Het
Loxhd1 A G 18: 77,361,736 D662G possibly damaging Het
Lrrc6 T C 15: 66,442,218 D311G probably benign Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Map2k3 T A 11: 60,943,491 I95N probably damaging Het
Mark1 A G 1: 184,905,610 I594T probably damaging Het
Mettl14 T C 3: 123,374,825 I189V possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Odf4 C A 11: 68,922,846 C133F probably damaging Het
Olfr976 T C 9: 39,956,920 N5S probably damaging Het
Opa1 A T 16: 29,597,620 Q106L probably damaging Het
Pax4 T G 6: 28,446,270 S75R probably damaging Het
Ppfibp1 T A 6: 147,022,131 probably null Het
Ptpn20 T C 14: 33,631,111 I269T probably benign Het
Ptprq T C 10: 107,524,331 Q2161R probably damaging Het
Rab22a A G 2: 173,661,487 D31G probably damaging Het
Rfx1 A G 8: 84,093,211 T692A probably damaging Het
Sf3b2 A G 19: 5,275,137 V769A probably damaging Het
Skint5 A T 4: 113,795,565 F621I unknown Het
Spink5 A C 18: 43,999,857 R513S possibly damaging Het
Srrm2 C T 17: 23,819,550 probably benign Het
Srrt A G 5: 137,296,773 probably null Het
Sun3 T C 11: 9,023,295 Q134R possibly damaging Het
Tpo A G 12: 30,105,980 V174A probably benign Het
Ucp1 A G 8: 83,294,203 R183G possibly damaging Het
Vmn2r66 A G 7: 85,006,809 V333A probably benign Het
Wdr60 C T 12: 116,255,866 R152H possibly damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp936 A G 7: 43,190,240 Q377R probably damaging Het
Zkscan2 T C 7: 123,499,867 E34G probably benign Het
Zufsp T A 10: 33,949,443 E14D probably damaging Het
Other mutations in Rap1gds1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Rap1gds1 APN 3 138983827 missense possibly damaging 0.95
IGL01314:Rap1gds1 APN 3 139050561 missense probably damaging 1.00
IGL01450:Rap1gds1 APN 3 138965920 missense probably damaging 1.00
IGL02033:Rap1gds1 APN 3 138955471 splice site probably benign
IGL02658:Rap1gds1 APN 3 138957479 missense probably damaging 1.00
IGL02745:Rap1gds1 APN 3 138956241 missense probably damaging 1.00
IGL02880:Rap1gds1 APN 3 138945756 missense probably benign 0.16
PIT4305001:Rap1gds1 UTSW 3 138956300 missense probably benign 0.05
R0006:Rap1gds1 UTSW 3 138983871 splice site probably null
R0006:Rap1gds1 UTSW 3 138983871 splice site probably null
R0585:Rap1gds1 UTSW 3 139021872 missense probably benign 0.16
R1573:Rap1gds1 UTSW 3 138965863 splice site probably null
R1793:Rap1gds1 UTSW 3 139050553 missense possibly damaging 0.94
R1960:Rap1gds1 UTSW 3 139050556 missense probably null 0.28
R2432:Rap1gds1 UTSW 3 138956250 missense probably damaging 0.99
R2697:Rap1gds1 UTSW 3 138983721 critical splice donor site probably null
R3792:Rap1gds1 UTSW 3 138965960 missense probably damaging 1.00
R4031:Rap1gds1 UTSW 3 139050592 splice site probably benign
R4194:Rap1gds1 UTSW 3 138959090 missense probably damaging 1.00
R4530:Rap1gds1 UTSW 3 138957425 missense probably damaging 1.00
R4696:Rap1gds1 UTSW 3 138927614 missense probably damaging 1.00
R4909:Rap1gds1 UTSW 3 138983748 missense possibly damaging 0.77
R5000:Rap1gds1 UTSW 3 138956250 missense probably damaging 1.00
R5046:Rap1gds1 UTSW 3 138955420 nonsense probably null
R5152:Rap1gds1 UTSW 3 138956201 missense probably damaging 1.00
R5309:Rap1gds1 UTSW 3 138958628 missense probably damaging 1.00
R5312:Rap1gds1 UTSW 3 138958628 missense probably damaging 1.00
R5782:Rap1gds1 UTSW 3 138959079 missense possibly damaging 0.65
R5825:Rap1gds1 UTSW 3 138955375 missense possibly damaging 0.93
R6547:Rap1gds1 UTSW 3 138955338 missense probably damaging 1.00
R7227:Rap1gds1 UTSW 3 138957467 missense probably damaging 1.00
R7228:Rap1gds1 UTSW 3 138957467 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGCTCGAGTTTTCAAGAG -3'
(R):5'- GCCCTGTGACATCAAAACTTGTG -3'

Sequencing Primer
(F):5'- TCGAGTTTTCAAGAGCCATCCAG -3'
(R):5'- GATTTTGTCCACATTGTTCCGTATG -3'
Posted On2016-06-21