Incidental Mutation 'R5163:Pax4'
ID397097
Institutional Source Beutler Lab
Gene Symbol Pax4
Ensembl Gene ENSMUSG00000029706
Gene Namepaired box 4
SynonymsPax-4
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.703) question?
Stock #R5163 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location28442334-28449353 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 28446270 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 75 (S75R)
Ref Sequence ENSEMBL: ENSMUSP00000134470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031718] [ENSMUST00000164519] [ENSMUST00000171089] [ENSMUST00000174194]
Predicted Effect probably damaging
Transcript: ENSMUST00000031718
AA Change: S75R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031718
Gene: ENSMUSG00000029706
AA Change: S75R

DomainStartEndE-ValueType
PAX 5 129 8.08e-83 SMART
HOX 170 232 8.92e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164519
AA Change: S75R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131301
Gene: ENSMUSG00000029706
AA Change: S75R

DomainStartEndE-ValueType
PAX 5 129 8.08e-83 SMART
HOX 170 232 8.92e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171089
AA Change: S75R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126000
Gene: ENSMUSG00000029706
AA Change: S75R

DomainStartEndE-ValueType
PAX 5 129 8.08e-83 SMART
HOX 170 232 8.92e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174036
Predicted Effect probably damaging
Transcript: ENSMUST00000174194
AA Change: S75R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134470
Gene: ENSMUSG00000029706
AA Change: S75R

DomainStartEndE-ValueType
PAX 5 129 8.08e-83 SMART
HOX 139 190 2.22e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174423
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the paired box (PAX) family of transcription factors. Members of this gene family typically contain a paired box domain, an octapeptide, and a paired-type homeodomain. These genes play critical roles during fetal development and cancer growth. The paired box 4 gene is involved in pancreatic islet development and mouse studies have demonstrated a role for this gene in differentiation of insulin-producing beta cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation lack mature insulin- and somatostatin-producing cells (beta and delta, respectively) in the pancreas, but contain glucagon-producing alpha cells in considerably higher numbers relative to wild-type mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Btbd19 T G 4: 117,121,431 I152L probably damaging Het
Ercc6l2 A G 13: 63,899,031 probably benign Het
Fat4 A G 3: 38,980,797 D2866G probably damaging Het
Fkbp10 C T 11: 100,423,099 A311V probably benign Het
Fnbp1l T C 3: 122,544,663 N511S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gltp A G 5: 114,674,061 I147T probably benign Het
Gpr37 A T 6: 25,669,615 I410N possibly damaging Het
Hivep2 G A 10: 14,139,425 G1779R probably damaging Het
Ifna14 T C 4: 88,571,362 Y146C probably damaging Het
Loxhd1 A G 18: 77,361,736 D662G possibly damaging Het
Lrrc6 T C 15: 66,442,218 D311G probably benign Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Map2k3 T A 11: 60,943,491 I95N probably damaging Het
Mark1 A G 1: 184,905,610 I594T probably damaging Het
Mettl14 T C 3: 123,374,825 I189V possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Odf4 C A 11: 68,922,846 C133F probably damaging Het
Olfr976 T C 9: 39,956,920 N5S probably damaging Het
Opa1 A T 16: 29,597,620 Q106L probably damaging Het
Ppfibp1 T A 6: 147,022,131 probably null Het
Ptpn20 T C 14: 33,631,111 I269T probably benign Het
Ptprq T C 10: 107,524,331 Q2161R probably damaging Het
Rab22a A G 2: 173,661,487 D31G probably damaging Het
Rap1gds1 A T 3: 138,959,056 M296K probably damaging Het
Rfx1 A G 8: 84,093,211 T692A probably damaging Het
Sf3b2 A G 19: 5,275,137 V769A probably damaging Het
Skint5 A T 4: 113,795,565 F621I unknown Het
Spink5 A C 18: 43,999,857 R513S possibly damaging Het
Srrm2 C T 17: 23,819,550 probably benign Het
Srrt A G 5: 137,296,773 probably null Het
Sun3 T C 11: 9,023,295 Q134R possibly damaging Het
Tpo A G 12: 30,105,980 V174A probably benign Het
Ucp1 A G 8: 83,294,203 R183G possibly damaging Het
Vmn2r66 A G 7: 85,006,809 V333A probably benign Het
Wdr60 C T 12: 116,255,866 R152H possibly damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp936 A G 7: 43,190,240 Q377R probably damaging Het
Zkscan2 T C 7: 123,499,867 E34G probably benign Het
Zufsp T A 10: 33,949,443 E14D probably damaging Het
Other mutations in Pax4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03150:Pax4 APN 6 28444339 missense probably null 1.00
R0034:Pax4 UTSW 6 28442449 missense probably benign
R1523:Pax4 UTSW 6 28444841 missense probably damaging 1.00
R1828:Pax4 UTSW 6 28443447 missense probably benign 0.02
R2014:Pax4 UTSW 6 28446210 missense probably benign 0.01
R4037:Pax4 UTSW 6 28443883 missense probably benign 0.00
R5117:Pax4 UTSW 6 28446279 missense probably benign 0.43
R5182:Pax4 UTSW 6 28444369 missense probably benign 0.19
R5200:Pax4 UTSW 6 28445139 missense probably damaging 1.00
R5713:Pax4 UTSW 6 28446185 missense probably damaging 1.00
R5902:Pax4 UTSW 6 28447127 missense probably benign 0.22
R6185:Pax4 UTSW 6 28446348 missense probably damaging 1.00
R6744:Pax4 UTSW 6 28442397 missense probably benign 0.00
R6923:Pax4 UTSW 6 28447119 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCCTTAACTCCAGCTTGAGATAC -3'
(R):5'- AAGGCTCACTTTGCTTTGTAGC -3'

Sequencing Primer
(F):5'- CTAAGGAAAGGGGGATCTTCTCC -3'
(R):5'- CTTCCTTCTGTCCCGGGAAGG -3'
Posted On2016-06-21