Incidental Mutation 'R5163:Zfp108'
ID397100
Institutional Source Beutler Lab
Gene Symbol Zfp108
Ensembl Gene ENSMUSG00000030486
Gene Namezinc finger protein 108
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5163 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location24254794-24262445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24260738 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 251 (K251N)
Ref Sequence ENSEMBL: ENSMUSP00000072496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072713] [ENSMUST00000205982] [ENSMUST00000206777]
Predicted Effect probably benign
Transcript: ENSMUST00000072713
AA Change: K251N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000072496
Gene: ENSMUSG00000030486
AA Change: K251N

DomainStartEndE-ValueType
KRAB 8 63 7.94e-18 SMART
low complexity region 140 153 N/A INTRINSIC
ZnF_C2H2 281 303 1.33e-1 SMART
ZnF_C2H2 309 331 1.69e-3 SMART
ZnF_C2H2 337 359 1.3e-4 SMART
ZnF_C2H2 365 387 2.71e-2 SMART
ZnF_C2H2 393 415 5.14e-3 SMART
ZnF_C2H2 421 443 1.87e-5 SMART
ZnF_C2H2 449 471 3.44e-4 SMART
ZnF_C2H2 477 497 1.08e1 SMART
ZnF_C2H2 503 525 3.89e-3 SMART
ZnF_C2H2 531 553 2.09e-3 SMART
ZnF_C2H2 559 581 4.61e-5 SMART
ZnF_C2H2 587 609 7.9e-4 SMART
ZnF_C2H2 615 637 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205982
AA Change: K251N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000206777
AA Change: K251N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Btbd19 T G 4: 117,121,431 I152L probably damaging Het
Ercc6l2 A G 13: 63,899,031 probably benign Het
Fat4 A G 3: 38,980,797 D2866G probably damaging Het
Fkbp10 C T 11: 100,423,099 A311V probably benign Het
Fnbp1l T C 3: 122,544,663 N511S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gltp A G 5: 114,674,061 I147T probably benign Het
Gpr37 A T 6: 25,669,615 I410N possibly damaging Het
Hivep2 G A 10: 14,139,425 G1779R probably damaging Het
Ifna14 T C 4: 88,571,362 Y146C probably damaging Het
Loxhd1 A G 18: 77,361,736 D662G possibly damaging Het
Lrrc6 T C 15: 66,442,218 D311G probably benign Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Map2k3 T A 11: 60,943,491 I95N probably damaging Het
Mark1 A G 1: 184,905,610 I594T probably damaging Het
Mettl14 T C 3: 123,374,825 I189V possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Odf4 C A 11: 68,922,846 C133F probably damaging Het
Olfr976 T C 9: 39,956,920 N5S probably damaging Het
Opa1 A T 16: 29,597,620 Q106L probably damaging Het
Pax4 T G 6: 28,446,270 S75R probably damaging Het
Ppfibp1 T A 6: 147,022,131 probably null Het
Ptpn20 T C 14: 33,631,111 I269T probably benign Het
Ptprq T C 10: 107,524,331 Q2161R probably damaging Het
Rab22a A G 2: 173,661,487 D31G probably damaging Het
Rap1gds1 A T 3: 138,959,056 M296K probably damaging Het
Rfx1 A G 8: 84,093,211 T692A probably damaging Het
Sf3b2 A G 19: 5,275,137 V769A probably damaging Het
Skint5 A T 4: 113,795,565 F621I unknown Het
Spink5 A C 18: 43,999,857 R513S possibly damaging Het
Srrm2 C T 17: 23,819,550 probably benign Het
Srrt A G 5: 137,296,773 probably null Het
Sun3 T C 11: 9,023,295 Q134R possibly damaging Het
Tpo A G 12: 30,105,980 V174A probably benign Het
Ucp1 A G 8: 83,294,203 R183G possibly damaging Het
Vmn2r66 A G 7: 85,006,809 V333A probably benign Het
Wdr60 C T 12: 116,255,866 R152H possibly damaging Het
Zfp936 A G 7: 43,190,240 Q377R probably damaging Het
Zkscan2 T C 7: 123,499,867 E34G probably benign Het
Zufsp T A 10: 33,949,443 E14D probably damaging Het
Other mutations in Zfp108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Zfp108 APN 7 24261486 missense possibly damaging 0.82
IGL01392:Zfp108 APN 7 24258447 splice site probably benign
R0123:Zfp108 UTSW 7 24260467 missense probably benign 0.00
R0126:Zfp108 UTSW 7 24260724 missense probably benign 0.01
R0134:Zfp108 UTSW 7 24260467 missense probably benign 0.00
R0243:Zfp108 UTSW 7 24261783 missense possibly damaging 0.81
R1227:Zfp108 UTSW 7 24260460 missense probably benign 0.00
R1464:Zfp108 UTSW 7 24260548 missense probably benign 0.00
R1464:Zfp108 UTSW 7 24260548 missense probably benign 0.00
R1731:Zfp108 UTSW 7 24258539 missense possibly damaging 0.75
R1739:Zfp108 UTSW 7 24261310 missense probably damaging 1.00
R1751:Zfp108 UTSW 7 24261896 missense probably damaging 1.00
R3713:Zfp108 UTSW 7 24261845 nonsense probably null
R3839:Zfp108 UTSW 7 24260556 missense probably benign 0.01
R3919:Zfp108 UTSW 7 24260832 missense probably damaging 0.99
R3922:Zfp108 UTSW 7 24261348 missense probably damaging 1.00
R4707:Zfp108 UTSW 7 24260412 missense probably benign 0.08
R4912:Zfp108 UTSW 7 24261314 missense probably damaging 1.00
R4965:Zfp108 UTSW 7 24260148 missense probably benign
R4989:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5014:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5183:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5184:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5185:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5453:Zfp108 UTSW 7 24261264 missense probably damaging 1.00
R5600:Zfp108 UTSW 7 24260586 missense probably benign 0.00
R6494:Zfp108 UTSW 7 24261357 missense probably damaging 1.00
R6601:Zfp108 UTSW 7 24261394 missense probably damaging 0.98
R6735:Zfp108 UTSW 7 24261772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTGCATTTCCCATCAAGATAAC -3'
(R):5'- GGATGTTGAGATCCGAGCTG -3'

Sequencing Primer
(F):5'- TTCCCATCAAGATAACAATATACTGC -3'
(R):5'- ACAGCTGTCGCACCTGTAG -3'
Posted On2016-06-21