Incidental Mutation 'R5163:Olfr976'
ID397106
Institutional Source Beutler Lab
Gene Symbol Olfr976
Ensembl Gene ENSMUSG00000047352
Gene Nameolfactory receptor 976
SynonymsGA_x6K02T2PVTD-33657378-33656440, MOR224-10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5163 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39954139-39961133 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39956920 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 5 (N5S)
Ref Sequence ENSEMBL: ENSMUSP00000150494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169307] [ENSMUST00000213171] [ENSMUST00000216647] [ENSMUST00000217360] [ENSMUST00000217630]
Predicted Effect probably damaging
Transcript: ENSMUST00000169307
AA Change: N17S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133083
Gene: ENSMUSG00000047352
AA Change: N17S

DomainStartEndE-ValueType
Pfam:7tm_4 43 318 1.5e-48 PFAM
Pfam:7TM_GPCR_Srsx 47 271 1.1e-5 PFAM
Pfam:7tm_1 53 300 2.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213171
AA Change: N5S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000216647
Predicted Effect probably damaging
Transcript: ENSMUST00000217360
AA Change: N5S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217630
AA Change: N5S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Btbd19 T G 4: 117,121,431 I152L probably damaging Het
Ercc6l2 A G 13: 63,899,031 probably benign Het
Fat4 A G 3: 38,980,797 D2866G probably damaging Het
Fkbp10 C T 11: 100,423,099 A311V probably benign Het
Fnbp1l T C 3: 122,544,663 N511S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gltp A G 5: 114,674,061 I147T probably benign Het
Gpr37 A T 6: 25,669,615 I410N possibly damaging Het
Hivep2 G A 10: 14,139,425 G1779R probably damaging Het
Ifna14 T C 4: 88,571,362 Y146C probably damaging Het
Loxhd1 A G 18: 77,361,736 D662G possibly damaging Het
Lrrc6 T C 15: 66,442,218 D311G probably benign Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Map2k3 T A 11: 60,943,491 I95N probably damaging Het
Mark1 A G 1: 184,905,610 I594T probably damaging Het
Mettl14 T C 3: 123,374,825 I189V possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Odf4 C A 11: 68,922,846 C133F probably damaging Het
Opa1 A T 16: 29,597,620 Q106L probably damaging Het
Pax4 T G 6: 28,446,270 S75R probably damaging Het
Ppfibp1 T A 6: 147,022,131 probably null Het
Ptpn20 T C 14: 33,631,111 I269T probably benign Het
Ptprq T C 10: 107,524,331 Q2161R probably damaging Het
Rab22a A G 2: 173,661,487 D31G probably damaging Het
Rap1gds1 A T 3: 138,959,056 M296K probably damaging Het
Rfx1 A G 8: 84,093,211 T692A probably damaging Het
Sf3b2 A G 19: 5,275,137 V769A probably damaging Het
Skint5 A T 4: 113,795,565 F621I unknown Het
Spink5 A C 18: 43,999,857 R513S possibly damaging Het
Srrm2 C T 17: 23,819,550 probably benign Het
Srrt A G 5: 137,296,773 probably null Het
Sun3 T C 11: 9,023,295 Q134R possibly damaging Het
Tpo A G 12: 30,105,980 V174A probably benign Het
Ucp1 A G 8: 83,294,203 R183G possibly damaging Het
Vmn2r66 A G 7: 85,006,809 V333A probably benign Het
Wdr60 C T 12: 116,255,866 R152H possibly damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp936 A G 7: 43,190,240 Q377R probably damaging Het
Zkscan2 T C 7: 123,499,867 E34G probably benign Het
Zufsp T A 10: 33,949,443 E14D probably damaging Het
Other mutations in Olfr976
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Olfr976 APN 9 39956159 missense probably damaging 1.00
IGL02455:Olfr976 APN 9 39956902 missense probably damaging 0.96
R1191:Olfr976 UTSW 9 39956968 start codon destroyed probably null 0.02
R1962:Olfr976 UTSW 9 39956683 missense probably benign 0.00
R2328:Olfr976 UTSW 9 39956900 missense possibly damaging 0.95
R3847:Olfr976 UTSW 9 39956581 missense probably damaging 1.00
R4032:Olfr976 UTSW 9 39956333 missense probably benign 0.14
R4620:Olfr976 UTSW 9 39956909 missense probably damaging 1.00
R5152:Olfr976 UTSW 9 39956906 missense probably benign 0.02
R5323:Olfr976 UTSW 9 39956829 nonsense probably null
R5709:Olfr976 UTSW 9 39956563 missense probably damaging 0.98
R7028:Olfr976 UTSW 9 39956345 missense probably benign 0.00
R7085:Olfr976 UTSW 9 39956512 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGTTCCCCAGGAAGAAATAC -3'
(R):5'- AAACAGTTGTTGCCAGTCTTCC -3'

Sequencing Primer
(F):5'- AAATACATGGGGGTGTGGAGGTTG -3'
(R):5'- GTTGCCAGTCTTCCCCACAAAAAG -3'
Posted On2016-06-21