Incidental Mutation 'R5163:Lrrc6'
ID397122
Institutional Source Beutler Lab
Gene Symbol Lrrc6
Ensembl Gene ENSMUSG00000022375
Gene Nameleucine rich repeat containing 6 (testis)
SynonymsLRTP
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R5163 (G1)
Quality Score107
Status Not validated
Chromosome15
Chromosomal Location66379858-66500910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66442218 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 311 (D311G)
Ref Sequence ENSEMBL: ENSMUSP00000023006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023006]
Predicted Effect probably benign
Transcript: ENSMUST00000023006
AA Change: D311G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000023006
Gene: ENSMUSG00000022375
AA Change: D311G

DomainStartEndE-ValueType
internal_repeat_1 23 65 8.03e-6 PROSPERO
internal_repeat_1 68 109 8.03e-6 PROSPERO
LRRcap 128 146 2.42e-2 SMART
low complexity region 178 204 N/A INTRINSIC
low complexity region 277 290 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 449 471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains several leucine-rich repeat domains and appears to be involved in the motility of cilia. Defects in this gene are a cause of primary ciliary dyskinesia-19 (CILD19). Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 4, 11 and 22. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Btbd19 T G 4: 117,121,431 I152L probably damaging Het
Ercc6l2 A G 13: 63,899,031 probably benign Het
Fat4 A G 3: 38,980,797 D2866G probably damaging Het
Fkbp10 C T 11: 100,423,099 A311V probably benign Het
Fnbp1l T C 3: 122,544,663 N511S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gltp A G 5: 114,674,061 I147T probably benign Het
Gpr37 A T 6: 25,669,615 I410N possibly damaging Het
Hivep2 G A 10: 14,139,425 G1779R probably damaging Het
Ifna14 T C 4: 88,571,362 Y146C probably damaging Het
Loxhd1 A G 18: 77,361,736 D662G possibly damaging Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Map2k3 T A 11: 60,943,491 I95N probably damaging Het
Mark1 A G 1: 184,905,610 I594T probably damaging Het
Mettl14 T C 3: 123,374,825 I189V possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Odf4 C A 11: 68,922,846 C133F probably damaging Het
Olfr976 T C 9: 39,956,920 N5S probably damaging Het
Opa1 A T 16: 29,597,620 Q106L probably damaging Het
Pax4 T G 6: 28,446,270 S75R probably damaging Het
Ppfibp1 T A 6: 147,022,131 probably null Het
Ptpn20 T C 14: 33,631,111 I269T probably benign Het
Ptprq T C 10: 107,524,331 Q2161R probably damaging Het
Rab22a A G 2: 173,661,487 D31G probably damaging Het
Rap1gds1 A T 3: 138,959,056 M296K probably damaging Het
Rfx1 A G 8: 84,093,211 T692A probably damaging Het
Sf3b2 A G 19: 5,275,137 V769A probably damaging Het
Skint5 A T 4: 113,795,565 F621I unknown Het
Spink5 A C 18: 43,999,857 R513S possibly damaging Het
Srrm2 C T 17: 23,819,550 probably benign Het
Srrt A G 5: 137,296,773 probably null Het
Sun3 T C 11: 9,023,295 Q134R possibly damaging Het
Tpo A G 12: 30,105,980 V174A probably benign Het
Ucp1 A G 8: 83,294,203 R183G possibly damaging Het
Vmn2r66 A G 7: 85,006,809 V333A probably benign Het
Wdr60 C T 12: 116,255,866 R152H possibly damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp936 A G 7: 43,190,240 Q377R probably damaging Het
Zkscan2 T C 7: 123,499,867 E34G probably benign Het
Zufsp T A 10: 33,949,443 E14D probably damaging Het
Other mutations in Lrrc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Lrrc6 APN 15 66481233 splice site probably benign
IGL01313:Lrrc6 APN 15 66380513 missense probably benign 0.00
IGL01739:Lrrc6 APN 15 66449477 missense probably benign
IGL01863:Lrrc6 APN 15 66396974 splice site probably benign
IGL02074:Lrrc6 APN 15 66489490 missense probably damaging 1.00
IGL02146:Lrrc6 APN 15 66489525 nonsense probably null
IGL02146:Lrrc6 APN 15 66489526 missense probably benign 0.08
IGL03194:Lrrc6 APN 15 66442199 missense probably benign 0.03
droopy UTSW 15 66447676 splice site probably benign
R0087:Lrrc6 UTSW 15 66469975 missense probably benign 0.00
R0178:Lrrc6 UTSW 15 66454101 missense probably benign 0.05
R0463:Lrrc6 UTSW 15 66380474 missense probably benign
R0539:Lrrc6 UTSW 15 66447606 missense probably damaging 0.99
R0608:Lrrc6 UTSW 15 66380474 missense probably benign
R1124:Lrrc6 UTSW 15 66438415 missense possibly damaging 0.92
R2209:Lrrc6 UTSW 15 66449551 missense probably benign 0.00
R2257:Lrrc6 UTSW 15 66437587 splice site probably benign
R2844:Lrrc6 UTSW 15 66447676 splice site probably benign
R2867:Lrrc6 UTSW 15 66438408 nonsense probably null
R2867:Lrrc6 UTSW 15 66438408 nonsense probably null
R4281:Lrrc6 UTSW 15 66380529 missense probably benign 0.35
R5636:Lrrc6 UTSW 15 66500816 utr 5 prime probably null
R6365:Lrrc6 UTSW 15 66454134 missense probably benign 0.00
R6567:Lrrc6 UTSW 15 66438379 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GAATTCTTCGAAGCAGGGAAC -3'
(R):5'- GTAAATTTATCCATAGGCTTTCTGGGC -3'

Sequencing Primer
(F):5'- AACCAAGTTCCATCTCTCTGTTACAG -3'
(R):5'- TCAGCATAGATGTCTTACTGTCTG -3'
Posted On2016-06-21