Incidental Mutation 'R5163:Spink5'
ID397127
Institutional Source Beutler Lab
Gene Symbol Spink5
Ensembl Gene ENSMUSG00000055561
Gene Nameserine peptidase inhibitor, Kazal type 5
Synonyms2310065D10Rik, LEKT1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5163 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location43963235-44022501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 43999857 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 513 (R513S)
Ref Sequence ENSEMBL: ENSMUSP00000066214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069245]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069245
AA Change: R513S

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: R513S

DomainStartEndE-ValueType
PDB:1UUC|A 26 77 3e-6 PDB
KAZAL 97 152 1.67e-15 SMART
KAZAL 161 216 2.07e-3 SMART
KAZAL 226 281 3.37e-11 SMART
KAZAL 298 353 2.92e-6 SMART
KAZAL 367 424 6.73e-3 SMART
KAZAL 426 480 6.07e-4 SMART
KAZAL 496 558 2.43e-1 SMART
KAZAL 559 614 2.72e-15 SMART
KAZAL 633 687 1.95e-7 SMART
KAZAL 700 755 1.01e-9 SMART
KAZAL 769 824 7.29e-7 SMART
KAZAL 865 931 1.32e-4 SMART
KAZAL 942 996 2.74e-11 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Btbd19 T G 4: 117,121,431 I152L probably damaging Het
Ercc6l2 A G 13: 63,899,031 probably benign Het
Fat4 A G 3: 38,980,797 D2866G probably damaging Het
Fkbp10 C T 11: 100,423,099 A311V probably benign Het
Fnbp1l T C 3: 122,544,663 N511S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gltp A G 5: 114,674,061 I147T probably benign Het
Gpr37 A T 6: 25,669,615 I410N possibly damaging Het
Hivep2 G A 10: 14,139,425 G1779R probably damaging Het
Ifna14 T C 4: 88,571,362 Y146C probably damaging Het
Loxhd1 A G 18: 77,361,736 D662G possibly damaging Het
Lrrc6 T C 15: 66,442,218 D311G probably benign Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Map2k3 T A 11: 60,943,491 I95N probably damaging Het
Mark1 A G 1: 184,905,610 I594T probably damaging Het
Mettl14 T C 3: 123,374,825 I189V possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Odf4 C A 11: 68,922,846 C133F probably damaging Het
Olfr976 T C 9: 39,956,920 N5S probably damaging Het
Opa1 A T 16: 29,597,620 Q106L probably damaging Het
Pax4 T G 6: 28,446,270 S75R probably damaging Het
Ppfibp1 T A 6: 147,022,131 probably null Het
Ptpn20 T C 14: 33,631,111 I269T probably benign Het
Ptprq T C 10: 107,524,331 Q2161R probably damaging Het
Rab22a A G 2: 173,661,487 D31G probably damaging Het
Rap1gds1 A T 3: 138,959,056 M296K probably damaging Het
Rfx1 A G 8: 84,093,211 T692A probably damaging Het
Sf3b2 A G 19: 5,275,137 V769A probably damaging Het
Skint5 A T 4: 113,795,565 F621I unknown Het
Srrm2 C T 17: 23,819,550 probably benign Het
Srrt A G 5: 137,296,773 probably null Het
Sun3 T C 11: 9,023,295 Q134R possibly damaging Het
Tpo A G 12: 30,105,980 V174A probably benign Het
Ucp1 A G 8: 83,294,203 R183G possibly damaging Het
Vmn2r66 A G 7: 85,006,809 V333A probably benign Het
Wdr60 C T 12: 116,255,866 R152H possibly damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp936 A G 7: 43,190,240 Q377R probably damaging Het
Zkscan2 T C 7: 123,499,867 E34G probably benign Het
Zufsp T A 10: 33,949,443 E14D probably damaging Het
Other mutations in Spink5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Spink5 APN 18 43987871 splice site probably benign
IGL00332:Spink5 APN 18 43967044 missense probably benign 0.00
IGL00501:Spink5 APN 18 43977739 missense probably damaging 0.98
IGL00772:Spink5 APN 18 44006420 missense probably benign 0.02
IGL00920:Spink5 APN 18 44003209 missense probably damaging 1.00
IGL00980:Spink5 APN 18 44007710 missense probably damaging 1.00
IGL01016:Spink5 APN 18 44007644 missense probably damaging 1.00
IGL01155:Spink5 APN 18 43981147 missense probably benign 0.01
IGL01374:Spink5 APN 18 43989404 missense possibly damaging 0.74
IGL01629:Spink5 APN 18 43996610 splice site probably benign
IGL01907:Spink5 APN 18 43996676 missense probably damaging 1.00
IGL01931:Spink5 APN 18 44015638 missense probably benign 0.02
IGL02237:Spink5 APN 18 44012867 missense probably benign 0.03
IGL02306:Spink5 APN 18 43964444 missense probably damaging 0.98
IGL02402:Spink5 APN 18 43967104 missense probably damaging 1.00
IGL02425:Spink5 APN 18 43990744 critical splice donor site probably null
IGL02552:Spink5 APN 18 43992168 missense possibly damaging 0.80
IGL02554:Spink5 APN 18 44015594 missense probably benign 0.01
IGL03066:Spink5 APN 18 44016390 missense probably damaging 1.00
IGL03288:Spink5 APN 18 44014760 missense possibly damaging 0.59
crusty2 UTSW 18 43999935 splice site probably benign
R0079:Spink5 UTSW 18 43977764 missense probably damaging 1.00
R0184:Spink5 UTSW 18 44003198 missense probably benign 0.00
R0452:Spink5 UTSW 18 43963318 missense possibly damaging 0.74
R0569:Spink5 UTSW 18 43989419 missense probably damaging 1.00
R0639:Spink5 UTSW 18 44012975 splice site probably null
R0648:Spink5 UTSW 18 43999797 splice site probably benign
R0705:Spink5 UTSW 18 43992274 missense probably benign 0.01
R1170:Spink5 UTSW 18 43983563 missense probably benign 0.07
R1290:Spink5 UTSW 18 44007711 missense probably damaging 0.99
R1345:Spink5 UTSW 18 43990682 missense possibly damaging 0.88
R1458:Spink5 UTSW 18 44007719 missense probably benign 0.01
R1530:Spink5 UTSW 18 44015671 missense probably damaging 0.96
R1570:Spink5 UTSW 18 43967107 missense probably benign 0.00
R1820:Spink5 UTSW 18 43989419 missense possibly damaging 0.94
R1843:Spink5 UTSW 18 43999891 missense probably benign 0.03
R1968:Spink5 UTSW 18 43990708 missense probably benign 0.06
R2050:Spink5 UTSW 18 44007758 critical splice donor site probably null
R2252:Spink5 UTSW 18 44020824 nonsense probably null
R2278:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2279:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2696:Spink5 UTSW 18 43982292 missense probably damaging 1.00
R2992:Spink5 UTSW 18 43996629 missense probably damaging 1.00
R3422:Spink5 UTSW 18 44010244 missense probably benign 0.01
R3934:Spink5 UTSW 18 44016427 missense probably damaging 1.00
R4179:Spink5 UTSW 18 43987867 missense probably benign
R4854:Spink5 UTSW 18 44020841 makesense probably null
R5011:Spink5 UTSW 18 44006412 missense probably damaging 0.97
R5133:Spink5 UTSW 18 43986423 missense probably damaging 1.00
R5185:Spink5 UTSW 18 44015644 missense probably damaging 0.97
R5187:Spink5 UTSW 18 43989451 missense probably damaging 1.00
R5292:Spink5 UTSW 18 44006454 missense probably benign
R5332:Spink5 UTSW 18 43992917 missense possibly damaging 0.89
R5600:Spink5 UTSW 18 44018711 missense probably damaging 0.96
R6267:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6296:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6373:Spink5 UTSW 18 43990672 missense probably damaging 1.00
R6982:Spink5 UTSW 18 43977725 missense probably damaging 1.00
R6982:Spink5 UTSW 18 44010042 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGCCCATCACAGAGTAGTGG -3'
(R):5'- TTGATGATAATATACCCTGCCCC -3'

Sequencing Primer
(F):5'- GGCTAAAGCTGATATCTGACATCAC -3'
(R):5'- GATGATAATATACCCTGCCCCCAAAC -3'
Posted On2016-06-21