Incidental Mutation 'R5163:Bcor'
ID397130
Institutional Source Beutler Lab
Gene Symbol Bcor
Ensembl Gene ENSMUSG00000040363
Gene NameBCL6 interacting corepressor
Synonyms5830466J11Rik, D930024N20Rik, 8430401K06Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.847) question?
Stock #R5163 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location12036740-12160355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12040486 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 1551 (R1551Q)
Ref Sequence ENSEMBL: ENSMUSP00000111175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043441] [ENSMUST00000065143] [ENSMUST00000115512] [ENSMUST00000115513] [ENSMUST00000124033]
Predicted Effect probably damaging
Transcript: ENSMUST00000043441
AA Change: R1499Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048024
Gene: ENSMUSG00000040363
AA Change: R1499Q

DomainStartEndE-ValueType
low complexity region 330 342 N/A INTRINSIC
low complexity region 552 580 N/A INTRINSIC
low complexity region 1374 1387 N/A INTRINSIC
ANK 1414 1444 1.6e1 SMART
ANK 1448 1477 8.26e-2 SMART
ANK 1481 1510 3.06e-5 SMART
low complexity region 1572 1583 N/A INTRINSIC
PDB:4HPL|A 1584 1700 1e-67 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000065143
AA Change: R1517Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068618
Gene: ENSMUSG00000040363
AA Change: R1517Q

DomainStartEndE-ValueType
low complexity region 330 342 N/A INTRINSIC
low complexity region 552 580 N/A INTRINSIC
low complexity region 1392 1405 N/A INTRINSIC
ANK 1432 1462 1.6e1 SMART
ANK 1466 1495 8.26e-2 SMART
ANK 1499 1528 3.06e-5 SMART
low complexity region 1590 1601 N/A INTRINSIC
PDB:4HPL|A 1602 1718 2e-67 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000115512
AA Change: R1533Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111174
Gene: ENSMUSG00000040363
AA Change: R1533Q

DomainStartEndE-ValueType
low complexity region 330 342 N/A INTRINSIC
low complexity region 552 580 N/A INTRINSIC
low complexity region 1408 1421 N/A INTRINSIC
ANK 1448 1478 1.6e1 SMART
ANK 1482 1511 8.26e-2 SMART
ANK 1515 1544 3.06e-5 SMART
low complexity region 1606 1617 N/A INTRINSIC
PDB:4HPL|A 1618 1734 2e-67 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000115513
AA Change: R1551Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111175
Gene: ENSMUSG00000040363
AA Change: R1551Q

DomainStartEndE-ValueType
low complexity region 330 342 N/A INTRINSIC
low complexity region 552 580 N/A INTRINSIC
Pfam:BCOR 1205 1417 1.6e-77 PFAM
low complexity region 1426 1439 N/A INTRINSIC
ANK 1466 1496 1.6e1 SMART
ANK 1500 1529 8.26e-2 SMART
ANK 1533 1562 3.06e-5 SMART
low complexity region 1624 1635 N/A INTRINSIC
Pfam:PUFD 1638 1751 5.6e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124033
AA Change: R1499Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116258
Gene: ENSMUSG00000040363
AA Change: R1499Q

DomainStartEndE-ValueType
low complexity region 330 342 N/A INTRINSIC
low complexity region 552 580 N/A INTRINSIC
low complexity region 1374 1387 N/A INTRINSIC
ANK 1414 1444 1.6e1 SMART
ANK 1448 1477 8.26e-2 SMART
ANK 1481 1510 3.06e-5 SMART
low complexity region 1572 1583 N/A INTRINSIC
PDB:4HPL|A 1584 1700 1e-67 PDB
Meta Mutation Damage Score 0.3992 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified as an interacting corepressor of BCL6, a POZ/zinc finger transcription repressor that is required for germinal center formation and may influence apoptosis. This protein selectively interacts with the POZ domain of BCL6, but not with eight other POZ proteins. Specific class I and II histone deacetylases (HDACs) have been shown to interact with this protein, which suggests a possible link between the two classes of HDACs. Several transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene is found on chromosome Y.[provided by RefSeq, Jun 2010]
PHENOTYPE: Male chimeras hemizygous for either of two different gene trapped alleles die by E9.5 exhibiting anomalies in somite formation and heart looping, forebrain fusion, and microcephaly. Hemizygosity for other gene trapped alleles can cause patterning and embryo turning defects or abnormal gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Btbd19 T G 4: 117,121,431 I152L probably damaging Het
Ercc6l2 A G 13: 63,899,031 probably benign Het
Fat4 A G 3: 38,980,797 D2866G probably damaging Het
Fkbp10 C T 11: 100,423,099 A311V probably benign Het
Fnbp1l T C 3: 122,544,663 N511S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gltp A G 5: 114,674,061 I147T probably benign Het
Gpr37 A T 6: 25,669,615 I410N possibly damaging Het
Hivep2 G A 10: 14,139,425 G1779R probably damaging Het
Ifna14 T C 4: 88,571,362 Y146C probably damaging Het
Loxhd1 A G 18: 77,361,736 D662G possibly damaging Het
Lrrc6 T C 15: 66,442,218 D311G probably benign Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Map2k3 T A 11: 60,943,491 I95N probably damaging Het
Mark1 A G 1: 184,905,610 I594T probably damaging Het
Mettl14 T C 3: 123,374,825 I189V possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Odf4 C A 11: 68,922,846 C133F probably damaging Het
Olfr976 T C 9: 39,956,920 N5S probably damaging Het
Opa1 A T 16: 29,597,620 Q106L probably damaging Het
Pax4 T G 6: 28,446,270 S75R probably damaging Het
Ppfibp1 T A 6: 147,022,131 probably null Het
Ptpn20 T C 14: 33,631,111 I269T probably benign Het
Ptprq T C 10: 107,524,331 Q2161R probably damaging Het
Rab22a A G 2: 173,661,487 D31G probably damaging Het
Rap1gds1 A T 3: 138,959,056 M296K probably damaging Het
Rfx1 A G 8: 84,093,211 T692A probably damaging Het
Sf3b2 A G 19: 5,275,137 V769A probably damaging Het
Skint5 A T 4: 113,795,565 F621I unknown Het
Spink5 A C 18: 43,999,857 R513S possibly damaging Het
Srrm2 C T 17: 23,819,550 probably benign Het
Srrt A G 5: 137,296,773 probably null Het
Sun3 T C 11: 9,023,295 Q134R possibly damaging Het
Tpo A G 12: 30,105,980 V174A probably benign Het
Ucp1 A G 8: 83,294,203 R183G possibly damaging Het
Vmn2r66 A G 7: 85,006,809 V333A probably benign Het
Wdr60 C T 12: 116,255,866 R152H possibly damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp936 A G 7: 43,190,240 Q377R probably damaging Het
Zkscan2 T C 7: 123,499,867 E34G probably benign Het
Zufsp T A 10: 33,949,443 E14D probably damaging Het
Other mutations in Bcor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Bcor APN X 12037820 missense probably damaging 0.99
IGL02034:Bcor APN X 12039259 missense possibly damaging 0.46
IGL02458:Bcor APN X 12048510 missense probably damaging 1.00
IGL03330:Bcor APN X 12058871 missense possibly damaging 0.65
R0648:Bcor UTSW X 12059051 missense probably damaging 1.00
R2147:Bcor UTSW X 12057623 missense possibly damaging 0.73
R2148:Bcor UTSW X 12057623 missense possibly damaging 0.73
R4941:Bcor UTSW X 12040486 missense probably damaging 1.00
R5004:Bcor UTSW X 12040486 missense probably damaging 1.00
R5162:Bcor UTSW X 12040486 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGCCCGAAACCATACTG -3'
(R):5'- TGTGTACTTGAGAGCTGACCC -3'

Sequencing Primer
(F):5'- CTGTGCACAGGTGAGTCAAAC -3'
(R):5'- CCCTTCACTGGTACTTTAGAAGAGAG -3'
Posted On2016-06-21