Incidental Mutation 'R4691:Adamts2'
ID397140
Institutional Source Beutler Lab
Gene Symbol Adamts2
Ensembl Gene ENSMUSG00000036545
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 2
SynonymsADAM-TS2, procollagen N-proteinase, hPCPNI, a disintegrin and metalloproteinase with thrombospondin repeats
MMRRC Submission 041942-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R4691 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location50602084-50807573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 50756696 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 299 (V299F)
Ref Sequence ENSEMBL: ENSMUSP00000040171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040523]
Predicted Effect probably damaging
Transcript: ENSMUST00000040523
AA Change: V299F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040171
Gene: ENSMUSG00000036545
AA Change: V299F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 44 52 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 211 2.6e-39 PFAM
low complexity region 214 225 N/A INTRINSIC
coiled coil region 236 260 N/A INTRINSIC
Pfam:Reprolysin_5 265 450 1.4e-15 PFAM
Pfam:Reprolysin_4 267 464 7.1e-11 PFAM
Pfam:Reprolysin 268 471 2.4e-20 PFAM
Pfam:Reprolysin_2 285 463 9.1e-14 PFAM
Pfam:Reprolysin_3 289 420 8.7e-13 PFAM
TSP1 565 617 9.73e-17 SMART
Pfam:ADAM_spacer1 724 838 5.1e-33 PFAM
low complexity region 839 853 N/A INTRINSIC
TSP1 858 915 1.05e-3 SMART
TSP1 918 977 2.78e-3 SMART
TSP1 980 1030 4.99e-5 SMART
Meta Mutation Damage Score 0.444 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin repeats) family of proteinases that is involved in the proteolytic processing of procollagens. The encoded protein precursor is proteolytically processed to generate a mature, zinc-dependent enzyme. Mice lacking the encoded protein develop abnormal lungs, fragile skin and male sterility. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous mutation of this gene results in a short snout, male infertility, and thin skin that is torn by scratching or handling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abca13 A T 11: 9,434,195 R3882S probably damaging Het
Ankrd50 A G 3: 38,483,010 S65P probably benign Het
Ap4e1 T C 2: 127,061,871 C898R probably benign Het
Arel1 A T 12: 84,930,249 probably null Het
Bag6 T A 17: 35,139,248 V164D probably damaging Het
C2cd5 A G 6: 143,030,148 S769P possibly damaging Het
Cables1 C T 18: 11,840,523 Q240* probably null Het
Ccnb1-ps T A 7: 42,106,092 noncoding transcript Het
Ccz1 A T 5: 143,991,562 I390N possibly damaging Het
Ces1a T C 8: 93,032,659 H283R probably benign Het
Clca3b G A 3: 144,839,092 T378I probably benign Het
Cpne2 A T 8: 94,558,221 I342F probably damaging Het
Cyp2d9 A G 15: 82,455,832 D141G probably damaging Het
Ddias T A 7: 92,858,816 K630N probably damaging Het
Dennd4b A G 3: 90,272,312 T626A probably damaging Het
Disc1 T C 8: 125,148,447 V554A possibly damaging Het
Dnah10 A G 5: 124,775,517 T1880A probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epop C T 11: 97,628,893 G130D possibly damaging Het
Erap1 T C 13: 74,673,692 L722P probably damaging Het
Eya4 T A 10: 23,140,068 T334S probably benign Het
Ezr T C 17: 6,759,562 I5V probably benign Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Galnt12 T C 4: 47,104,143 S134P probably damaging Het
Gcfc2 T A 6: 81,941,427 L366* probably null Het
Gins4 T A 8: 23,237,059 D6V probably benign Het
Gm1113 T C 9: 35,516,862 S106G possibly damaging Het
Gm5155 T A 7: 17,908,966 S434T possibly damaging Het
Grid1 A G 14: 35,569,557 H807R probably benign Het
H2-T22 GTTTT GTTT 17: 36,041,570 probably null Het
Ighv1-66 T C 12: 115,593,309 Y51C probably benign Het
Inpp4b A T 8: 82,122,653 Y901F probably damaging Het
Irf2 T A 8: 46,846,187 S339T probably damaging Het
Itgae G T 11: 73,119,519 G612* probably null Het
Kdr T C 5: 75,944,599 K1037R possibly damaging Het
Mro A T 18: 73,873,326 M115L probably benign Het
Myo5a A G 9: 75,180,156 E1098G probably damaging Het
Nkx2-1 T A 12: 56,533,565 M197L probably benign Het
Olfr58 T C 9: 19,783,382 I83T probably benign Het
Pank2 T A 2: 131,296,281 F430L possibly damaging Het
Pcx T A 19: 4,619,477 V794E probably damaging Het
Pdgfd C T 9: 6,288,556 P70L probably damaging Het
Pla2g4e T C 2: 120,174,300 Y521C probably damaging Het
Pou5f1 T A 17: 35,506,131 F11Y probably damaging Het
Prdm9 A G 17: 15,553,378 M252T probably benign Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rad51ap1 A G 6: 126,927,553 S123P probably benign Het
Robo3 T C 9: 37,425,218 E418G probably damaging Het
Sos2 C T 12: 69,616,328 R631H probably damaging Het
St3gal2 C T 8: 110,957,785 T25I probably benign Het
Stra6l G A 4: 45,882,851 A521T probably benign Het
Syt7 T A 19: 10,426,481 L177Q probably damaging Het
Tet2 T A 3: 133,486,083 Q863H possibly damaging Het
Tmem232 T C 17: 65,265,242 K585E possibly damaging Het
Trpc6 A C 9: 8,652,978 E595A probably damaging Het
Txnl1 A G 18: 63,671,679 V248A possibly damaging Het
Vmn2r72 A T 7: 85,737,911 L815* probably null Het
Vmn2r81 C T 10: 79,293,377 Q701* probably null Het
Vps13c T C 9: 67,952,935 V2811A possibly damaging Het
Zfp354a A G 11: 51,070,237 E425G probably damaging Het
Zfp617 A T 8: 71,932,815 T330S probably benign Het
Zfp663 G T 2: 165,359,130 probably benign Het
Zfp84 T C 7: 29,777,080 L399P probably damaging Het
Zfp869 A T 8: 69,706,863 C353* probably null Het
Zscan22 C T 7: 12,906,561 A85V probably benign Het
Other mutations in Adamts2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Adamts2 APN 11 50803701 missense probably benign 0.00
IGL01366:Adamts2 APN 11 50796468 missense probably damaging 1.00
IGL01412:Adamts2 APN 11 50795403 missense probably benign 0.43
IGL01443:Adamts2 APN 11 50803863 missense possibly damaging 0.54
IGL01974:Adamts2 APN 11 50776174 missense probably damaging 0.99
IGL02267:Adamts2 APN 11 50792678 missense probably benign 0.00
IGL02498:Adamts2 APN 11 50773308 missense possibly damaging 0.81
IGL02498:Adamts2 APN 11 50777196 missense probably damaging 1.00
IGL02626:Adamts2 APN 11 50776255 missense probably damaging 0.99
IGL02634:Adamts2 APN 11 50792721 nonsense probably null
IGL02643:Adamts2 APN 11 50788700 missense probably benign 0.01
IGL02836:Adamts2 APN 11 50787279 missense probably damaging 1.00
IGL03012:Adamts2 APN 11 50776269 splice site probably benign
ANU22:Adamts2 UTSW 11 50737363 missense probably benign 0.06
H8441:Adamts2 UTSW 11 50784678 missense probably damaging 1.00
R0050:Adamts2 UTSW 11 50775395 missense probably damaging 1.00
R0050:Adamts2 UTSW 11 50775395 missense probably damaging 1.00
R0240:Adamts2 UTSW 11 50775374 missense probably damaging 1.00
R0240:Adamts2 UTSW 11 50775374 missense probably damaging 1.00
R0491:Adamts2 UTSW 11 50776630 missense probably damaging 0.98
R0501:Adamts2 UTSW 11 50668145 missense probably benign 0.16
R0570:Adamts2 UTSW 11 50776136 missense probably damaging 1.00
R0588:Adamts2 UTSW 11 50776664 missense probably damaging 1.00
R0647:Adamts2 UTSW 11 50603438 missense probably damaging 1.00
R0760:Adamts2 UTSW 11 50775326 missense probably damaging 1.00
R0784:Adamts2 UTSW 11 50668003 missense probably damaging 1.00
R1163:Adamts2 UTSW 11 50779714 missense probably damaging 1.00
R1623:Adamts2 UTSW 11 50668115 missense possibly damaging 0.79
R1641:Adamts2 UTSW 11 50792785 missense probably damaging 1.00
R1779:Adamts2 UTSW 11 50756697 missense probably damaging 0.99
R2163:Adamts2 UTSW 11 50788805 missense probably benign 0.36
R2177:Adamts2 UTSW 11 50777228 missense probably damaging 0.98
R2508:Adamts2 UTSW 11 50788689 missense possibly damaging 0.82
R3721:Adamts2 UTSW 11 50773211 splice site probably benign
R4092:Adamts2 UTSW 11 50787276 missense probably damaging 0.99
R4785:Adamts2 UTSW 11 50792722 missense probably benign 0.00
R4809:Adamts2 UTSW 11 50803690 missense probably benign 0.17
R4823:Adamts2 UTSW 11 50737187 missense probably benign 0.26
R4927:Adamts2 UTSW 11 50803812 nonsense probably null
R4976:Adamts2 UTSW 11 50737366 missense possibly damaging 0.67
R5118:Adamts2 UTSW 11 50781869 missense probably damaging 0.99
R5478:Adamts2 UTSW 11 50792651 missense possibly damaging 0.83
R5660:Adamts2 UTSW 11 50776645 missense probably damaging 1.00
R5734:Adamts2 UTSW 11 50788667 missense probably damaging 1.00
R5865:Adamts2 UTSW 11 50803954 nonsense probably null
R6079:Adamts2 UTSW 11 50756706 missense probably damaging 1.00
R6138:Adamts2 UTSW 11 50756706 missense probably damaging 1.00
R6257:Adamts2 UTSW 11 50775326 missense probably damaging 1.00
R6540:Adamts2 UTSW 11 50788740 missense possibly damaging 0.77
R6897:Adamts2 UTSW 11 50737164 critical splice acceptor site probably null
R7103:Adamts2 UTSW 11 50737354 missense probably damaging 0.98
R7229:Adamts2 UTSW 11 50791820 missense probably damaging 1.00
R7261:Adamts2 UTSW 11 50786597 missense possibly damaging 0.48
R7335:Adamts2 UTSW 11 50602266 missense probably benign 0.18
R7373:Adamts2 UTSW 11 50795435 missense probably benign 0.00
U15987:Adamts2 UTSW 11 50756706 missense probably damaging 1.00
X0065:Adamts2 UTSW 11 50803649 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCCAGGCAGGTGTTTGTAGC -3'
(R):5'- ACCCTAGAGTGTCCAGAGAAAG -3'

Sequencing Primer
(F):5'- TTTGTAGCAGCCAGGGC -3'
(R):5'- CCTAGAGTGTCCAGAGAAAGTCAGG -3'
Posted On2016-06-24