Incidental Mutation 'R4751:Eif4g1'
ID397147
Institutional Source Beutler Lab
Gene Symbol Eif4g1
Ensembl Gene ENSMUSG00000045983
Gene Nameeukaryotic translation initiation factor 4, gamma 1
SynonymsE030015G23Rik
MMRRC Submission 041970-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R4751 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location20668313-20692884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20686515 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1208 (K1208E)
Ref Sequence ENSEMBL: ENSMUSP00000111123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044783] [ENSMUST00000073840] [ENSMUST00000115457] [ENSMUST00000115460] [ENSMUST00000115461] [ENSMUST00000115463] [ENSMUST00000128594] [ENSMUST00000142344] [ENSMUST00000143939] [ENSMUST00000150333] [ENSMUST00000156226]
Predicted Effect probably benign
Transcript: ENSMUST00000044783
AA Change: K1222E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000047678
Gene: ENSMUSG00000045983
AA Change: K1222E

DomainStartEndE-ValueType
low complexity region 60 81 N/A INTRINSIC
PDB:1LJ2|D 179 206 1e-10 PDB
low complexity region 260 286 N/A INTRINSIC
low complexity region 436 457 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
Blast:MIF4G 638 683 7e-9 BLAST
low complexity region 685 707 N/A INTRINSIC
MIF4G 765 993 5.14e-72 SMART
low complexity region 1035 1047 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
low complexity region 1157 1178 N/A INTRINSIC
low complexity region 1186 1201 N/A INTRINSIC
MA3 1242 1354 3.83e-39 SMART
low complexity region 1441 1452 N/A INTRINSIC
eIF5C 1508 1595 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073840
AA Change: K1215E

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000073506
Gene: ENSMUSG00000045983
AA Change: K1215E

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 1e-10 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 676 7e-9 BLAST
low complexity region 678 700 N/A INTRINSIC
MIF4G 758 986 5.14e-72 SMART
low complexity region 1028 1040 N/A INTRINSIC
low complexity region 1085 1099 N/A INTRINSIC
low complexity region 1150 1171 N/A INTRINSIC
low complexity region 1179 1194 N/A INTRINSIC
MA3 1235 1347 3.83e-39 SMART
low complexity region 1434 1445 N/A INTRINSIC
eIF5C 1501 1588 3.78e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104051
Predicted Effect probably benign
Transcript: ENSMUST00000115457
AA Change: K1175E

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000111117
Gene: ENSMUSG00000045983
AA Change: K1175E

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
PDB:1LJ2|D 132 159 9e-11 PDB
low complexity region 213 239 N/A INTRINSIC
low complexity region 389 410 N/A INTRINSIC
low complexity region 417 440 N/A INTRINSIC
Blast:MIF4G 591 636 7e-9 BLAST
low complexity region 638 660 N/A INTRINSIC
MIF4G 718 946 5.14e-72 SMART
low complexity region 988 1000 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1110 1131 N/A INTRINSIC
low complexity region 1139 1154 N/A INTRINSIC
MA3 1195 1307 3.83e-39 SMART
low complexity region 1394 1405 N/A INTRINSIC
eIF5C 1461 1548 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115460
AA Change: K1222E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000111120
Gene: ENSMUSG00000045983
AA Change: K1222E

DomainStartEndE-ValueType
low complexity region 60 81 N/A INTRINSIC
PDB:1LJ2|D 179 206 1e-10 PDB
low complexity region 260 286 N/A INTRINSIC
low complexity region 436 457 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
Blast:MIF4G 638 683 7e-9 BLAST
low complexity region 685 707 N/A INTRINSIC
MIF4G 765 993 5.14e-72 SMART
low complexity region 1035 1047 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
low complexity region 1157 1178 N/A INTRINSIC
low complexity region 1186 1201 N/A INTRINSIC
MA3 1242 1354 3.83e-39 SMART
low complexity region 1441 1452 N/A INTRINSIC
eIF5C 1508 1595 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115461
AA Change: K1216E

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000111121
Gene: ENSMUSG00000045983
AA Change: K1216E

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 1e-10 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 676 8e-9 BLAST
low complexity region 678 693 N/A INTRINSIC
MIF4G 759 987 5.14e-72 SMART
low complexity region 1029 1041 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
low complexity region 1151 1172 N/A INTRINSIC
low complexity region 1180 1195 N/A INTRINSIC
MA3 1236 1348 3.83e-39 SMART
low complexity region 1435 1446 N/A INTRINSIC
eIF5C 1502 1589 3.78e-33 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115463
AA Change: K1208E

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111123
Gene: ENSMUSG00000045983
AA Change: K1208E

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 1e-10 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 676 7e-9 BLAST
low complexity region 678 700 N/A INTRINSIC
MIF4G 758 986 5.14e-72 SMART
low complexity region 1030 1036 N/A INTRINSIC
low complexity region 1078 1092 N/A INTRINSIC
low complexity region 1143 1164 N/A INTRINSIC
low complexity region 1172 1187 N/A INTRINSIC
MA3 1228 1340 3.83e-39 SMART
low complexity region 1427 1438 N/A INTRINSIC
eIF5C 1494 1581 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128594
SMART Domains Protein: ENSMUSP00000144594
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
PDB:1LJ2|D 8 35 5e-11 PDB
low complexity region 89 115 N/A INTRINSIC
low complexity region 265 286 N/A INTRINSIC
low complexity region 293 316 N/A INTRINSIC
Blast:MIF4G 467 512 4e-9 BLAST
low complexity region 514 536 N/A INTRINSIC
MIF4G 594 795 1.1e-52 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137690
Predicted Effect probably benign
Transcript: ENSMUST00000142344
SMART Domains Protein: ENSMUSP00000116029
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 5e-11 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 672 6e-8 BLAST
low complexity region 678 693 N/A INTRINSIC
MIF4G 759 958 5.49e-49 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000143939
AA Change: K925E

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144320
Gene: ENSMUSG00000045983
AA Change: K925E

DomainStartEndE-ValueType
low complexity region 139 160 N/A INTRINSIC
low complexity region 167 190 N/A INTRINSIC
Blast:MIF4G 341 386 6e-9 BLAST
low complexity region 388 410 N/A INTRINSIC
MIF4G 468 696 2.2e-74 SMART
low complexity region 738 750 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 860 881 N/A INTRINSIC
low complexity region 889 904 N/A INTRINSIC
MA3 945 1057 1.7e-41 SMART
low complexity region 1144 1155 N/A INTRINSIC
eIF5C 1211 1298 1.8e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150333
SMART Domains Protein: ENSMUSP00000144107
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
PDB:1LJ2|D 113 140 5e-11 PDB
low complexity region 194 220 N/A INTRINSIC
low complexity region 370 391 N/A INTRINSIC
low complexity region 398 421 N/A INTRINSIC
Blast:MIF4G 572 613 9e-8 BLAST
low complexity region 619 641 N/A INTRINSIC
MIF4G 699 900 1.1e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156226
SMART Domains Protein: ENSMUSP00000119215
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231477
Predicted Effect probably benign
Transcript: ENSMUST00000231598
Meta Mutation Damage Score 0.346 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 95% (124/131)
MGI Phenotype FUNCTION: This gene encodes a member of the eukaryotic translation initiation factors (eIF) that play important roles in translation initiation by mediating recruitment of additional initiation factors and providing a scaffold for ribosome/mRNA-bridging. Along with eIF4A and eIF4E, the encoded protein forms the eIF4F complex that bridges the 5' UTR with the polyadenylated 3' UTR resulting in mRNA circularization, enhanced translation initiation and mRNA stability. Through its association with eIF3, the encoded protein mediates recruitment of the 43S pre-initiation complex to mRNA. Alternative splicing of this gene results in multiple transcript variants. Pseudogenes for this gene have been identified on chromosomes 2 and 13. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for an amino acid substitution (R1207H) are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A T 7: 128,237,086 C112S probably benign Het
Abca13 G A 11: 9,277,973 probably null Het
Abca14 A G 7: 120,312,177 E1328G probably benign Het
Abca9 T A 11: 110,130,570 I1105F probably benign Het
Abr T C 11: 76,456,608 N396D possibly damaging Het
Aftph A C 11: 20,727,074 C178W probably damaging Het
Akr1c14 T C 13: 4,065,338 F89S possibly damaging Het
Ank3 C T 10: 69,986,206 A1518V probably benign Het
Arfgap2 T G 2: 91,267,368 S143R probably benign Het
Aspdh T A 7: 44,467,205 C107* probably null Het
Asphd2 C A 5: 112,391,746 G74W probably damaging Het
AU040320 G A 4: 126,854,466 probably null Het
B3glct T A 5: 149,725,402 probably null Het
Bcl9l A G 9: 44,506,803 K646R probably damaging Het
Brat1 T G 5: 140,718,296 L768R probably damaging Het
Btbd18 T A 2: 84,667,921 Y634* probably null Het
Bub1 T A 2: 127,823,938 probably benign Het
Carns1 A T 19: 4,166,418 D588E probably damaging Het
Cast T C 13: 74,746,047 K141E probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chsy3 T C 18: 59,175,800 S42P possibly damaging Het
Clca1 A T 3: 145,004,848 F865I possibly damaging Het
Clec4f T A 6: 83,645,282 M526L possibly damaging Het
Clnk T C 5: 38,720,913 E301G probably benign Het
Colgalt2 T A 1: 152,489,876 I309N probably benign Het
Cyp2e1 A T 7: 140,774,716 K326* probably null Het
Dagla T A 19: 10,250,394 T717S probably benign Het
Dnajc11 G A 4: 151,968,542 R141H probably benign Het
Dst A G 1: 34,191,884 K2853E probably benign Het
Elane A G 10: 79,886,791 R48G probably benign Het
Fbxo30 T A 10: 11,290,195 N220K probably benign Het
Fbxo33 A T 12: 59,200,928 probably benign Het
Fetub G A 16: 22,937,895 V169I probably benign Het
Gm13762 A G 2: 88,973,133 C253R probably damaging Het
Gm5861 T A 5: 11,186,491 Y138N probably damaging Het
Gpx6 A C 13: 21,317,064 Q107H probably damaging Het
Hist2h2bb A T 3: 96,269,151 probably benign Het
Homer3 A T 8: 70,285,434 I19F probably damaging Het
Hspa4 C T 11: 53,284,199 V144I probably benign Het
Icos C T 1: 60,993,717 S25L probably benign Het
Ifna4 A G 4: 88,841,948 T30A probably benign Het
Ino80b C T 6: 83,124,750 G46D probably damaging Het
Kpna2 T G 11: 106,992,664 I100L possibly damaging Het
Krt71 C T 15: 101,735,466 G446R probably damaging Het
Krtap31-2 A G 11: 99,936,576 N78S possibly damaging Het
Lman1 A G 18: 65,998,434 S132P probably benign Het
Lmna T C 3: 88,486,533 Q246R possibly damaging Het
Lrp10 T A 14: 54,468,592 V413E probably damaging Het
Macf1 A C 4: 123,471,650 I1541S probably benign Het
Med24 A G 11: 98,706,432 L874P probably damaging Het
Mgll T A 6: 88,725,111 probably benign Het
Mrpl37 A T 4: 107,057,475 L364Q probably damaging Het
Mrpl47 C T 3: 32,728,441 R209H probably benign Het
Muc5ac T C 7: 141,817,601 F3285L probably benign Het
Mylk A G 16: 34,879,169 R301G probably benign Het
Nacad A G 11: 6,605,726 L8P unknown Het
Ncf1 T A 5: 134,229,545 H8L probably damaging Het
Ncoa3 T A 2: 166,069,903 M1383K possibly damaging Het
Necab2 C T 8: 119,467,598 S271L probably benign Het
Nme8 A T 13: 19,675,638 probably null Het
Nsrp1 T G 11: 77,076,719 T16P possibly damaging Het
Obox3 A T 7: 15,625,692 probably null Het
Olfr1211 T A 2: 88,929,914 I134F probably damaging Het
Olfr1416 C A 1: 92,479,983 A213S probably benign Het
Olfr1428 T A 19: 12,109,177 Y123F probably damaging Het
Olfr355 T C 2: 36,927,583 H177R probably damaging Het
Olfr667 A T 7: 104,916,410 Y295* probably null Het
Osbpl3 C G 6: 50,300,997 E790Q possibly damaging Het
Osmr A T 15: 6,842,852 W254R probably damaging Het
Otoa T C 7: 121,132,924 probably benign Het
Pagr1a A T 7: 127,015,379 L218H probably damaging Het
Pcdha11 G A 18: 37,006,944 G542D probably damaging Het
Pck2 T A 14: 55,542,561 I54N probably damaging Het
Ppif T C 14: 25,699,499 V173A probably damaging Het
Ptgs2 T A 1: 150,104,020 L292H probably damaging Het
Ptpru A G 4: 131,802,586 S604P probably damaging Het
Qrfpr T C 3: 36,182,622 H210R possibly damaging Het
Rasgrf1 A G 9: 89,910,118 T41A probably damaging Het
Rasgrf1 A G 9: 90,012,866 H1113R probably damaging Het
Rhoc T A 3: 104,792,647 I80N probably damaging Het
Riok3 A G 18: 12,153,983 N472S probably benign Het
Rnf213 A G 11: 119,445,745 Y3314C probably benign Het
Shank2 C T 7: 144,409,468 T264I probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 A G 12: 82,341,194 I65V probably benign Het
Slc22a19 T C 19: 7,691,145 K291R possibly damaging Het
Slc22a20 T C 19: 5,980,460 I315V probably benign Het
Slc44a1 A T 4: 53,560,973 D563V probably damaging Het
Smchd1 A T 17: 71,391,468 H1104Q probably benign Het
Spcs2 A T 7: 99,844,769 probably null Het
Sptb T C 12: 76,627,110 E301G probably benign Het
Stum T C 1: 180,442,669 D86G probably damaging Het
Sufu A T 19: 46,483,649 D449V probably benign Het
Sun5 T C 2: 153,866,016 probably null Het
Tbc1d15 T A 10: 115,202,587 I574F probably damaging Het
Tert G A 13: 73,628,063 S311N possibly damaging Het
Tiparp T C 3: 65,552,804 Y507H probably damaging Het
Tnk2 T C 16: 32,679,857 C158R probably damaging Het
Tpgs1 T C 10: 79,675,620 S199P possibly damaging Het
Trdmt1 G T 2: 13,544,653 probably benign Het
Trp53bp1 T A 2: 121,227,809 D944V probably damaging Het
Tsc1 T A 2: 28,679,081 I720N probably damaging Het
Ttn T C 2: 76,709,605 T34346A probably benign Het
Ttn T C 2: 76,897,581 probably benign Het
Uba7 T A 9: 107,979,805 C686S possibly damaging Het
Ush2a T A 1: 188,850,087 F3782L probably damaging Het
Vars2 A T 17: 35,659,343 H745Q possibly damaging Het
Vgf T A 5: 137,032,401 D472E probably damaging Het
Vmn2r15 T C 5: 109,286,754 M695V probably benign Het
Vps41 A T 13: 18,811,622 D208V probably damaging Het
Vta1 C T 10: 14,655,816 A272T probably benign Het
Wnk4 G A 11: 101,276,362 probably benign Het
Zfp507 T C 7: 35,794,382 K412R probably damaging Het
Zfp768 A G 7: 127,344,762 F65L possibly damaging Het
Zfp956 T C 6: 47,963,576 S290P probably benign Het
Other mutations in Eif4g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Eif4g1 APN 16 20686754 intron probably benign
IGL00707:Eif4g1 APN 16 20689014 missense probably damaging 1.00
IGL00950:Eif4g1 APN 16 20683628 missense probably damaging 1.00
IGL01397:Eif4g1 APN 16 20679675 missense probably damaging 0.98
IGL01657:Eif4g1 APN 16 20682216 missense possibly damaging 0.94
IGL01875:Eif4g1 APN 16 20681040 missense probably damaging 0.96
IGL02728:Eif4g1 APN 16 20686752 intron probably benign
IGL03155:Eif4g1 APN 16 20692417 missense probably damaging 1.00
IGL03339:Eif4g1 APN 16 20680984 missense possibly damaging 0.72
R0032:Eif4g1 UTSW 16 20685898 missense probably damaging 1.00
R0032:Eif4g1 UTSW 16 20685898 missense probably damaging 1.00
R0138:Eif4g1 UTSW 16 20675345 missense probably damaging 0.99
R0556:Eif4g1 UTSW 16 20675794 missense probably damaging 0.99
R0576:Eif4g1 UTSW 16 20684068 missense probably damaging 0.98
R1424:Eif4g1 UTSW 16 20678942 missense probably benign 0.03
R1469:Eif4g1 UTSW 16 20680008 missense possibly damaging 0.86
R1469:Eif4g1 UTSW 16 20680008 missense possibly damaging 0.86
R1487:Eif4g1 UTSW 16 20678873 unclassified probably benign
R1659:Eif4g1 UTSW 16 20681061 missense probably damaging 0.99
R1697:Eif4g1 UTSW 16 20679780 missense probably damaging 0.99
R1848:Eif4g1 UTSW 16 20681867 missense probably damaging 1.00
R1855:Eif4g1 UTSW 16 20687161 missense possibly damaging 0.77
R1865:Eif4g1 UTSW 16 20678648 missense probably damaging 0.99
R3001:Eif4g1 UTSW 16 20692384 missense probably damaging 1.00
R3002:Eif4g1 UTSW 16 20692384 missense probably damaging 1.00
R4402:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4477:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4478:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4479:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4480:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4623:Eif4g1 UTSW 16 20681345 unclassified probably benign
R4658:Eif4g1 UTSW 16 20685934 missense possibly damaging 0.78
R4859:Eif4g1 UTSW 16 20682173 missense probably benign 0.44
R5267:Eif4g1 UTSW 16 20685533 missense probably damaging 0.99
R5376:Eif4g1 UTSW 16 20683827 missense probably damaging 1.00
R5560:Eif4g1 UTSW 16 20686895 missense probably benign
R5719:Eif4g1 UTSW 16 20689011 missense probably damaging 1.00
R6632:Eif4g1 UTSW 16 20685520 missense probably damaging 0.99
R6849:Eif4g1 UTSW 16 20680745 missense probably benign 0.08
R7134:Eif4g1 UTSW 16 20681502 missense probably damaging 1.00
X0062:Eif4g1 UTSW 16 20684501 missense probably damaging 1.00
X0065:Eif4g1 UTSW 16 20682726 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTAGCCTCACAGAGGATC -3'
(R):5'- TGAAGAAGAAAACCATCATTGCCG -3'

Sequencing Primer
(F):5'- TCACAGAGGATCGTGGTCG -3'
(R):5'- AACCATCATTGCCGGGTCC -3'
Posted On2016-06-24