Incidental Mutation 'R4711:Spag9'
ID397188
Institutional Source Beutler Lab
Gene Symbol Spag9
Ensembl Gene ENSMUSG00000020859
Gene Namesperm associated antigen 9
Synonymssyd1, JIP4, Mapk8ip4, 4733401I23Rik, JLP, 3110018C07Rik, 4831406C20Rik
Accession Numbers

Genbank: NM_027569; MGI: 1918084

Is this an essential gene? Possibly essential (E-score: 0.607) question?
Stock #R4711 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location93996091-94126085 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 94114351 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024979] [ENSMUST00000041956] [ENSMUST00000075695] [ENSMUST00000092777] [ENSMUST00000103168] [ENSMUST00000153076]
Predicted Effect probably null
Transcript: ENSMUST00000024979
SMART Domains Protein: ENSMUSP00000024979
Gene: ENSMUSG00000020859

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 253 305 1e-25 PDB
low complexity region 306 339 N/A INTRINSIC
coiled coil region 572 606 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
SCOP:d1kb0a2 823 969 3e-5 SMART
Blast:WD40 924 964 8e-18 BLAST
low complexity region 1132 1150 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000041956
SMART Domains Protein: ENSMUSP00000042271
Gene: ENSMUSG00000020859

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 24 179 2e-61 PFAM
Pfam:JIP_LZII 390 460 5.3e-32 PFAM
coiled coil region 710 744 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
SCOP:d1kb0a2 961 1107 1e-5 SMART
Blast:WD40 1062 1102 1e-17 BLAST
low complexity region 1270 1288 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000075695
SMART Domains Protein: ENSMUSP00000075115
Gene: ENSMUSG00000020859

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 253 305 1e-25 PDB
low complexity region 306 339 N/A INTRINSIC
coiled coil region 571 605 N/A INTRINSIC
low complexity region 734 750 N/A INTRINSIC
SCOP:d1kb0a2 822 968 3e-5 SMART
Blast:WD40 923 963 7e-18 BLAST
low complexity region 1131 1149 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000092777
SMART Domains Protein: ENSMUSP00000090452
Gene: ENSMUSG00000020859

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 254 306 1e-25 PDB
low complexity region 307 340 N/A INTRINSIC
coiled coil region 572 606 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
SCOP:d1kb0a2 823 969 3e-5 SMART
Blast:WD40 924 964 7e-18 BLAST
low complexity region 1132 1150 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103168
SMART Domains Protein: ENSMUSP00000099457
Gene: ENSMUSG00000020859

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2W83|D 249 301 1e-25 PDB
low complexity region 302 335 N/A INTRINSIC
coiled coil region 567 601 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
SCOP:d1kb0a2 818 964 3e-5 SMART
Blast:WD40 919 959 8e-18 BLAST
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000153076
SMART Domains Protein: ENSMUSP00000117502
Gene: ENSMUSG00000020859

DomainStartEndE-ValueType
PDB:2W83|D 1 25 4e-8 PDB
low complexity region 26 59 N/A INTRINSIC
coiled coil region 291 325 N/A INTRINSIC
low complexity region 454 470 N/A INTRINSIC
SCOP:d1kb0a2 542 688 3e-5 SMART
Blast:WD40 643 683 1e-17 BLAST
low complexity region 864 882 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cancer testis antigen gene family. The encoded protein functions as a scaffold protein that structurally organizes mitogen-activated protein kinases and mediates c-Jun-terminal kinase signaling. This protein also binds to kinesin-1 and may be involved in microtubule-based membrane transport. This protein may play a role in tumor growth and development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Male mice homozygous for a null mutation display reduced fertility with oligoasthenozoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg14 G A 14: 47,545,841 R346C probably damaging Het
BC005561 T C 5: 104,519,661 V683A probably damaging Het
BC037034 T C 5: 138,262,905 probably benign Het
Bin3 A G 14: 70,128,839 probably null Het
Ccser1 A G 6: 61,311,926 N358D possibly damaging Het
Col20a1 G C 2: 180,992,491 G83A probably damaging Het
Copa T G 1: 172,119,988 F1124V probably damaging Het
Cyp2c66 G A 19: 39,163,399 R186H possibly damaging Het
Dmxl2 G A 9: 54,450,924 T323M probably benign Het
Dner T C 1: 84,383,897 I664V possibly damaging Het
Erp29 A G 5: 121,445,230 I211T possibly damaging Het
Exd1 A G 2: 119,538,751 S128P possibly damaging Het
Gm8394 A G 10: 85,313,803 noncoding transcript Het
Grik4 T A 9: 42,629,093 N264Y probably damaging Het
Gsdma2 T A 11: 98,649,613 S119R probably damaging Het
Hist1h2aa C T 13: 23,934,813 P118S possibly damaging Het
Ift140 T A 17: 25,094,717 probably null Het
Ino80c T C 18: 24,114,165 N59S probably benign Het
Maob T C X: 16,716,423 T400A probably benign Het
Mast4 A G 13: 103,334,119 V25A probably benign Het
Mr1 T C 1: 155,136,590 T193A probably benign Het
Muc5b C A 7: 141,846,033 F414L unknown Het
Nat10 A T 2: 103,748,267 C197* probably null Het
Nt5c1b A G 12: 10,370,093 K11E probably damaging Het
Olfr1104 T C 2: 87,022,026 I173V probably damaging Het
Olfr175-ps1 A T 16: 58,824,706 M1K probably null Het
Pak7 A G 2: 136,087,517 I582T probably damaging Het
Pcdha12 A G 18: 37,020,923 I232V probably benign Het
Pde8b T A 13: 95,030,450 T664S probably benign Het
Pdik1l G C 4: 134,278,990 R214G probably benign Het
Prss37 C T 6: 40,515,447 V157M probably benign Het
Ring1 T C 17: 34,022,359 E261G possibly damaging Het
Sf3a3 C A 4: 124,728,181 D371E probably benign Het
Spred1 T A 2: 117,175,385 S209R probably benign Het
Tas2r121 T C 6: 132,700,890 T40A probably benign Het
Tbc1d5 T C 17: 50,935,509 T187A probably damaging Het
Tenm2 C T 11: 36,300,212 V311I probably damaging Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Ttn G A 2: 76,830,060 A7439V possibly damaging Het
Wdr64 T C 1: 175,799,229 I838T probably damaging Het
Wdr7 A G 18: 63,728,465 T183A probably benign Het
Other mutations in Spag9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Spag9 APN 11 94097866 missense probably benign 0.02
IGL01776:Spag9 APN 11 94116727 splice site probably benign
IGL02095:Spag9 APN 11 94108582 missense probably damaging 1.00
IGL02307:Spag9 APN 11 94102160 critical splice donor site probably null
IGL02417:Spag9 APN 11 94116741 missense probably benign 0.27
IGL02480:Spag9 APN 11 94108587 nonsense probably null
IGL02864:Spag9 APN 11 94106661 missense probably damaging 1.00
IGL02976:Spag9 APN 11 94083953 missense probably benign 0.30
IGL02979:Spag9 APN 11 94097364 missense probably benign
IGL03349:Spag9 APN 11 94093509 missense possibly damaging 0.51
dazzle UTSW 11 94093624 nonsense probably null
R0128:Spag9 UTSW 11 94093539 missense probably damaging 1.00
R0418:Spag9 UTSW 11 94091753 splice site probably benign
R1463:Spag9 UTSW 11 94116837 missense probably damaging 1.00
R1593:Spag9 UTSW 11 94097233 missense probably damaging 1.00
R1605:Spag9 UTSW 11 94048539 missense probably damaging 0.99
R1649:Spag9 UTSW 11 94108452 splice site probably null
R1697:Spag9 UTSW 11 93996565 missense probably benign 0.00
R1952:Spag9 UTSW 11 94097358 missense possibly damaging 0.77
R2011:Spag9 UTSW 11 94092375 nonsense probably null
R2012:Spag9 UTSW 11 94092375 nonsense probably null
R2351:Spag9 UTSW 11 94092900 missense probably damaging 1.00
R2367:Spag9 UTSW 11 94116757 missense probably damaging 1.00
R3027:Spag9 UTSW 11 94086377 missense probably null 1.00
R3766:Spag9 UTSW 11 94060283 intron probably benign
R3777:Spag9 UTSW 11 94099026 critical splice acceptor site probably null
R3937:Spag9 UTSW 11 94044417 missense possibly damaging 0.94
R3937:Spag9 UTSW 11 94044479 missense possibly damaging 0.92
R4417:Spag9 UTSW 11 94060346 intron probably benign
R4445:Spag9 UTSW 11 94097253 missense possibly damaging 0.95
R4799:Spag9 UTSW 11 94048516 missense possibly damaging 0.87
R4799:Spag9 UTSW 11 94048517 missense probably damaging 0.96
R4816:Spag9 UTSW 11 94048599 intron probably benign
R4843:Spag9 UTSW 11 94097818 missense probably damaging 1.00
R5020:Spag9 UTSW 11 94097786 missense probably benign 0.08
R5119:Spag9 UTSW 11 94122722 missense probably damaging 1.00
R5298:Spag9 UTSW 11 94100135 missense probably damaging 1.00
R5304:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5305:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5395:Spag9 UTSW 11 94091751 splice site probably null
R5636:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5638:Spag9 UTSW 11 94069012 missense probably damaging 1.00
R5654:Spag9 UTSW 11 94090712 missense probably damaging 1.00
R5779:Spag9 UTSW 11 94114253 missense probably benign 0.20
R5814:Spag9 UTSW 11 94082828 missense possibly damaging 0.94
R5912:Spag9 UTSW 11 94044425 missense probably damaging 0.98
R6038:Spag9 UTSW 11 94112092 missense probably damaging 1.00
R6038:Spag9 UTSW 11 94112092 missense probably damaging 1.00
R6269:Spag9 UTSW 11 94044507 missense probably benign 0.05
R6294:Spag9 UTSW 11 94093485 critical splice acceptor site probably null
R6389:Spag9 UTSW 11 94086311 missense probably damaging 1.00
R6420:Spag9 UTSW 11 94086302 missense probably damaging 1.00
R6460:Spag9 UTSW 11 94068975 missense probably damaging 1.00
R6482:Spag9 UTSW 11 94093502 missense possibly damaging 0.94
R6860:Spag9 UTSW 11 94081370 missense probably benign 0.25
R7086:Spag9 UTSW 11 94097864 missense not run
Predicted Primers PCR Primer
(F):5'- ACCAGTAACCTCTTGCATCAG -3'
(R):5'- GAGAGGTTGCAAAATAACTTCATCC -3'

Sequencing Primer
(F):5'- CAGTAACCTCTTGCATCAGTACTAG -3'
(R):5'- CTCCTTTATAGAGCCTCCTTAG -3'
Posted On2016-06-28