Incidental Mutation 'R4724:Hmcn1'
ID397227
Institutional Source Beutler Lab
Gene Symbol Hmcn1
Ensembl Gene ENSMUSG00000066842
Gene Namehemicentin 1
SynonymsLOC240793, EG545370
MMRRC Submission 041988-MU
Accession Numbers

Ncbi RefSeq: NM_001024720.3; MGI:2685047

Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R4724 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location150562524-150993435 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 150694833 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074783] [ENSMUST00000137197]
Predicted Effect probably null
Transcript: ENSMUST00000074783
SMART Domains Protein: ENSMUSP00000074340
Gene: ENSMUSG00000066842

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
Pfam:G2F 4869 5051 1.5e-57 PFAM
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5354 4.32e-10 SMART
low complexity region 5384 5400 N/A INTRINSIC
low complexity region 5401 5412 N/A INTRINSIC
EGF_CA 5431 5470 2.78e-13 SMART
EGF 5474 5516 1.44e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137197
SMART Domains Protein: ENSMUSP00000121500
Gene: ENSMUSG00000066842

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
PDB:1GL4|A 4869 5082 3e-6 PDB
SCOP:d1gl4a1 4869 5082 3e-79 SMART
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5353 2.78e-13 SMART
EGF 5357 5399 1.44e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177268
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large extracellular member of the immunoglobulin superfamily. A similar protein in C. elegans forms long, fine tracks at specific extracellular sites that are involved in many processes such as stabilization of the germline syncytium, anchorage of mechanosensory neurons to the epidermis, and organization of hemidesmosomes in the epidermis. Mutations in this gene may be associated with age-related macular degeneration. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik C G 3: 90,053,541 Q34E probably damaging Het
4933434E20Rik A T 3: 90,053,542 Q34L probably damaging Het
4933434E20Rik G T 3: 90,053,583 V48F probably damaging Het
8430408G22Rik T A 6: 116,652,135 C146* probably null Het
Abra T C 15: 41,865,906 D366G probably damaging Het
Acvr2a T C 2: 48,870,435 S68P probably damaging Het
Adam28 T A 14: 68,626,877 R492S probably damaging Het
Adamts1 T A 16: 85,802,505 E69V probably benign Het
Adgra1 A T 7: 139,875,589 M378L probably benign Het
Adgra2 T A 8: 27,098,822 N101K possibly damaging Het
Adhfe1 T A 1: 9,576,250 F449L probably damaging Het
Akap6 T A 12: 52,795,885 S5R possibly damaging Het
Akap9 G A 5: 4,055,339 R2883Q probably benign Het
Ank3 T A 10: 69,706,858 I16N probably benign Het
Api5 A T 2: 94,423,471 F296I possibly damaging Het
Ceacam14 G T 7: 17,814,050 probably null Het
Cep295 C T 9: 15,330,832 G1768S probably damaging Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Cp C A 3: 19,972,647 T413K probably benign Het
Ctdsp2 T G 10: 126,993,069 V104G probably damaging Het
Ctrc T A 4: 141,846,296 probably null Het
Dbt T C 3: 116,533,296 I98T probably damaging Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dctn1 T A 6: 83,189,938 M257K possibly damaging Het
Dlgap5 C T 14: 47,401,520 probably null Het
Drd3 G T 16: 43,822,801 E467* probably null Het
Exoc8 A G 8: 124,897,250 V126A probably benign Het
Fam185a T A 5: 21,455,787 S267T probably damaging Het
Fhod1 T C 8: 105,337,861 probably benign Het
Fn1 T C 1: 71,648,148 probably null Het
Gadl1 A T 9: 115,954,617 T214S possibly damaging Het
Gem G T 4: 11,706,074 R54L probably damaging Het
Ghr A G 15: 3,325,940 V287A probably benign Het
Gm3642 G A 14: 6,833,344 T215I probably benign Het
Grip1 T A 10: 120,038,683 I732K probably benign Het
Gtpbp2 A T 17: 46,167,221 probably null Het
Heatr6 C T 11: 83,779,548 R976* probably null Het
Hipk2 T A 6: 38,698,392 T1084S probably benign Het
Hspg2 T A 4: 137,522,127 M1328K probably damaging Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Ighv1-64 A G 12: 115,507,846 V17A probably benign Het
Iqgap2 G T 13: 95,635,497 N1391K possibly damaging Het
Irf7 A T 7: 141,264,735 L148Q possibly damaging Het
Kat6b G A 14: 21,660,962 R768K probably benign Het
Lepr G A 4: 101,765,365 W447* probably null Het
Letmd1 A G 15: 100,469,738 Y59C probably damaging Het
Lingo4 A T 3: 94,402,876 K374* probably null Het
Loxl4 G T 19: 42,608,346 D62E probably benign Het
Lrfn2 A G 17: 49,070,434 D181G probably damaging Het
Lrrc71 A T 3: 87,739,174 F526L probably damaging Het
Ltbp1 A T 17: 75,313,008 M711L probably damaging Het
Mcm7 A T 5: 138,169,125 D78E probably damaging Het
Mdh1 T C 11: 21,562,957 N136D probably damaging Het
Meltf T A 16: 31,892,505 N515K probably benign Het
Mis18bp1 T A 12: 65,158,739 T220S probably benign Het
Mtss1 C T 15: 59,081,518 V4M probably damaging Het
Nacc2 A T 2: 26,090,173 F84I probably damaging Het
Nedd9 A G 13: 41,316,597 V360A possibly damaging Het
Nek11 T A 9: 105,392,970 I18F possibly damaging Het
Nkd2 C T 13: 73,847,005 V13M probably damaging Het
Nkx6-3 A G 8: 23,156,269 I152V probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr1 A T 11: 73,395,155 I289N probably damaging Het
Olfr1352 A G 10: 78,984,522 H244R probably damaging Het
Olfr1434 T C 19: 12,283,096 L16P probably damaging Het
Olfr215 T C 6: 116,582,937 N3S probably damaging Het
Olfr494 T A 7: 108,367,998 F169L probably benign Het
Olfr66 A G 7: 103,881,649 V198A probably benign Het
Oprm1 A T 10: 6,758,656 R16* probably null Het
Ostf1 G A 19: 18,593,867 P62L probably damaging Het
Pcdha2 A T 18: 36,940,515 T400S possibly damaging Het
Pcdha5 A T 18: 36,961,496 T353S possibly damaging Het
Pelo A G 13: 115,088,735 F318S probably damaging Het
Polr2f T C 15: 79,146,069 V36A probably benign Het
Ppan G A 9: 20,888,510 R41H probably benign Het
Ppp1r21 C T 17: 88,555,591 R253* probably null Het
Prf1 T A 10: 61,303,708 W482R probably damaging Het
Ralgapa2 T C 2: 146,345,533 T1397A possibly damaging Het
Rev3l T A 10: 39,846,806 Y2598* probably null Het
Scaf11 G T 15: 96,414,848 D1437E probably benign Het
Sec23a C T 12: 58,978,506 G510R probably damaging Het
Sel1l2 A G 2: 140,240,927 M597T probably damaging Het
Slc11a2 A T 15: 100,406,338 S160T possibly damaging Het
Slc18a1 A T 8: 69,073,649 L129* probably null Het
Smg8 A C 11: 87,086,221 L178R probably benign Het
Sp4 T C 12: 118,261,809 T607A probably benign Het
Ssbp2 A G 13: 91,688,814 D266G possibly damaging Het
Sstr3 A T 15: 78,539,697 Y283* probably null Het
Stk32b C T 5: 37,454,934 probably null Het
Svep1 T C 4: 58,070,752 T2345A possibly damaging Het
Synpo2 A G 3: 123,114,291 S459P probably damaging Het
Sytl2 A G 7: 90,348,792 M1V probably null Het
Tas2r102 T A 6: 132,762,557 W143R probably damaging Het
Thy1 T C 9: 44,047,348 V129A probably damaging Het
Tlr2 A T 3: 83,838,185 I197N probably damaging Het
Tmem101 A G 11: 102,153,443 I206T probably benign Het
Tmem108 A G 9: 103,499,489 S254P possibly damaging Het
Tmem198b T C 10: 128,801,481 Q263R probably damaging Het
Vangl1 T C 3: 102,184,554 D72G probably damaging Het
Vmn1r4 T A 6: 56,957,364 D284E probably benign Het
Vmn2r31 G A 7: 7,384,758 L605F possibly damaging Het
Zfand4 T C 6: 116,273,819 V70A probably damaging Het
Zfp54 A G 17: 21,433,403 E53G probably damaging Het
Zfp541 A T 7: 16,081,687 I805F probably damaging Het
Zfp976 T C 7: 42,613,033 H460R possibly damaging Het
Other mutations in Hmcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Hmcn1 APN 1 150677278 missense probably benign
IGL00571:Hmcn1 APN 1 150638999 missense probably benign 0.05
IGL00726:Hmcn1 APN 1 150806366 critical splice donor site probably null
IGL00802:Hmcn1 APN 1 150664936 missense probably benign 0.19
IGL00824:Hmcn1 APN 1 150656734 missense probably damaging 1.00
IGL00834:Hmcn1 APN 1 150630340 missense probably benign 0.00
IGL00843:Hmcn1 APN 1 150610713 missense possibly damaging 0.95
IGL00845:Hmcn1 APN 1 150605006 missense probably damaging 0.98
IGL00851:Hmcn1 APN 1 150582301 missense probably benign 0.02
IGL00909:Hmcn1 APN 1 150638869 missense probably benign 0.12
IGL01074:Hmcn1 APN 1 150627033 missense possibly damaging 0.82
IGL01112:Hmcn1 APN 1 150632552 splice site probably benign
IGL01304:Hmcn1 APN 1 150622924 missense probably damaging 0.99
IGL01307:Hmcn1 APN 1 150745001 missense possibly damaging 0.84
IGL01318:Hmcn1 APN 1 150719240 missense probably damaging 1.00
IGL01403:Hmcn1 APN 1 150593097 missense probably damaging 1.00
IGL01417:Hmcn1 APN 1 150859239 missense probably damaging 1.00
IGL01503:Hmcn1 APN 1 150605072 missense probably benign 0.38
IGL01509:Hmcn1 APN 1 150609631 missense probably damaging 1.00
IGL01550:Hmcn1 APN 1 150598397 missense probably damaging 1.00
IGL01601:Hmcn1 APN 1 150627413 missense probably benign 0.01
IGL01617:Hmcn1 APN 1 150672032 missense probably benign 0.05
IGL01636:Hmcn1 APN 1 150580233 missense probably damaging 1.00
IGL01662:Hmcn1 APN 1 150737299 missense possibly damaging 0.46
IGL01693:Hmcn1 APN 1 150583280 missense probably damaging 1.00
IGL01723:Hmcn1 APN 1 150744960 missense probably benign 0.01
IGL01776:Hmcn1 APN 1 150672038 missense possibly damaging 0.70
IGL01783:Hmcn1 APN 1 150615300 missense possibly damaging 0.60
IGL01789:Hmcn1 APN 1 150690601 missense probably damaging 1.00
IGL01900:Hmcn1 APN 1 150742260 splice site probably benign
IGL01906:Hmcn1 APN 1 150667887 missense probably benign 0.01
IGL01947:Hmcn1 APN 1 150732892 missense possibly damaging 0.93
IGL01958:Hmcn1 APN 1 150603871 missense probably benign 0.01
IGL02002:Hmcn1 APN 1 150615298 missense probably damaging 1.00
IGL02058:Hmcn1 APN 1 150704181 missense probably benign 0.02
IGL02115:Hmcn1 APN 1 150630728 missense probably damaging 1.00
IGL02127:Hmcn1 APN 1 150722607 missense probably benign
IGL02155:Hmcn1 APN 1 150563598 missense probably damaging 1.00
IGL02222:Hmcn1 APN 1 150806401 missense probably benign 0.05
IGL02293:Hmcn1 APN 1 150664915 missense probably damaging 0.97
IGL02398:Hmcn1 APN 1 150802897 missense possibly damaging 0.78
IGL02420:Hmcn1 APN 1 150722424 missense probably damaging 1.00
IGL02553:Hmcn1 APN 1 150993023 missense probably benign 0.12
IGL02561:Hmcn1 APN 1 150809726 missense probably benign 0.32
IGL02569:Hmcn1 APN 1 150697493 missense probably benign 0.01
IGL02607:Hmcn1 APN 1 150744995 missense possibly damaging 0.88
IGL02676:Hmcn1 APN 1 150619009 missense probably benign 0.01
IGL02725:Hmcn1 APN 1 150604903 missense possibly damaging 0.92
IGL02726:Hmcn1 APN 1 150656694 nonsense probably null
IGL02735:Hmcn1 APN 1 150646832 missense probably benign 0.02
IGL02737:Hmcn1 APN 1 150563828 missense probably damaging 1.00
IGL02892:Hmcn1 APN 1 150675974 critical splice donor site probably null
IGL02927:Hmcn1 APN 1 150577278 missense probably damaging 1.00
IGL02931:Hmcn1 APN 1 150657207 missense probably benign 0.37
IGL02936:Hmcn1 APN 1 150697522 missense probably damaging 0.98
IGL02985:Hmcn1 APN 1 150671917 missense probably damaging 1.00
IGL03027:Hmcn1 APN 1 150808539 missense probably benign
IGL03195:Hmcn1 APN 1 150802909 missense probably benign 0.06
IGL03217:Hmcn1 APN 1 150743667 missense possibly damaging 0.58
IGL03232:Hmcn1 APN 1 150770352 splice site probably benign
IGL03268:Hmcn1 APN 1 150772510 missense probably damaging 1.00
IGL03271:Hmcn1 APN 1 150598424 missense possibly damaging 0.92
IGL03304:Hmcn1 APN 1 150630231 missense probably damaging 0.97
IGL03329:Hmcn1 APN 1 150732910 missense probably damaging 1.00
IGL03339:Hmcn1 APN 1 150701969 missense probably benign 0.04
IGL03368:Hmcn1 APN 1 150663872 missense probably damaging 1.00
backbone UTSW 1 150622994 missense probably benign 0.09
cambrian UTSW 1 150732846 missense probably damaging 1.00
chordate UTSW 1 150587015 missense probably benign 0.00
lancelet UTSW 1 150675540 missense probably benign 0.00
notochord UTSW 1 150770293 missense probably benign 0.00
IGL02991:Hmcn1 UTSW 1 150738658 missense possibly damaging 0.56
P0017:Hmcn1 UTSW 1 150720689 missense possibly damaging 0.49
PIT1430001:Hmcn1 UTSW 1 150808737 missense probably benign 0.00
PIT4514001:Hmcn1 UTSW 1 150669487 missense possibly damaging 0.93
R0006:Hmcn1 UTSW 1 150808676 missense probably damaging 0.99
R0018:Hmcn1 UTSW 1 150652551 missense probably benign 0.16
R0052:Hmcn1 UTSW 1 150677406 missense probably damaging 1.00
R0107:Hmcn1 UTSW 1 150587015 missense probably benign 0.00
R0115:Hmcn1 UTSW 1 150808647 missense possibly damaging 0.88
R0149:Hmcn1 UTSW 1 150677324 missense probably benign 0.00
R0152:Hmcn1 UTSW 1 150663879 missense probably benign 0.01
R0381:Hmcn1 UTSW 1 150603811 missense probably damaging 1.00
R0398:Hmcn1 UTSW 1 150798814 missense possibly damaging 0.83
R0414:Hmcn1 UTSW 1 150715822 missense possibly damaging 0.72
R0494:Hmcn1 UTSW 1 150732792 splice site probably benign
R0503:Hmcn1 UTSW 1 150859252 missense probably damaging 1.00
R0504:Hmcn1 UTSW 1 150876419 splice site probably benign
R0506:Hmcn1 UTSW 1 150742341 missense possibly damaging 0.69
R0554:Hmcn1 UTSW 1 150719117 missense probably benign 0.34
R0576:Hmcn1 UTSW 1 150650017 nonsense probably null
R0599:Hmcn1 UTSW 1 150609801 missense possibly damaging 0.91
R0605:Hmcn1 UTSW 1 150657376 critical splice donor site probably null
R0607:Hmcn1 UTSW 1 150638900 missense probably benign 0.01
R0620:Hmcn1 UTSW 1 150594016 missense probably benign 0.04
R0626:Hmcn1 UTSW 1 150798719 splice site probably null
R0699:Hmcn1 UTSW 1 150819410 missense probably damaging 1.00
R0765:Hmcn1 UTSW 1 150808787 missense probably damaging 1.00
R0782:Hmcn1 UTSW 1 150753665 missense possibly damaging 0.82
R0783:Hmcn1 UTSW 1 150650073 missense probably damaging 1.00
R0841:Hmcn1 UTSW 1 150679607 splice site probably null
R0975:Hmcn1 UTSW 1 150577377 missense probably benign 0.00
R1070:Hmcn1 UTSW 1 150689590 missense probably damaging 0.98
R1118:Hmcn1 UTSW 1 150618928 missense possibly damaging 0.56
R1119:Hmcn1 UTSW 1 150618928 missense possibly damaging 0.56
R1145:Hmcn1 UTSW 1 150679607 splice site probably null
R1145:Hmcn1 UTSW 1 150679607 splice site probably null
R1233:Hmcn1 UTSW 1 150749026 missense probably benign
R1234:Hmcn1 UTSW 1 150753654 nonsense probably null
R1291:Hmcn1 UTSW 1 150748191 missense probably damaging 1.00
R1334:Hmcn1 UTSW 1 150586468 missense possibly damaging 0.73
R1372:Hmcn1 UTSW 1 150680715 missense probably benign 0.22
R1424:Hmcn1 UTSW 1 150646794 missense probably benign 0.00
R1450:Hmcn1 UTSW 1 150652506 splice site probably benign
R1458:Hmcn1 UTSW 1 150609700 missense probably damaging 1.00
R1467:Hmcn1 UTSW 1 150689590 missense probably damaging 0.98
R1467:Hmcn1 UTSW 1 150689590 missense probably damaging 0.98
R1473:Hmcn1 UTSW 1 150772552 missense probably benign 0.03
R1517:Hmcn1 UTSW 1 150669421 missense probably damaging 1.00
R1527:Hmcn1 UTSW 1 150773803 missense probably benign 0.00
R1557:Hmcn1 UTSW 1 150734532 missense possibly damaging 0.86
R1576:Hmcn1 UTSW 1 150657241 missense possibly damaging 0.77
R1617:Hmcn1 UTSW 1 150745027 missense probably damaging 0.98
R1635:Hmcn1 UTSW 1 150669558 missense probably benign 0.00
R1655:Hmcn1 UTSW 1 150630333 missense probably benign 0.03
R1698:Hmcn1 UTSW 1 150565369 nonsense probably null
R1710:Hmcn1 UTSW 1 150675984 missense probably damaging 1.00
R1717:Hmcn1 UTSW 1 150859186 missense probably damaging 1.00
R1753:Hmcn1 UTSW 1 150586468 missense possibly damaging 0.73
R1756:Hmcn1 UTSW 1 150599030 missense probably damaging 1.00
R1772:Hmcn1 UTSW 1 150563568 missense probably damaging 0.99
R1793:Hmcn1 UTSW 1 150749083 missense probably benign 0.01
R1794:Hmcn1 UTSW 1 150598285 missense probably benign 0.00
R1794:Hmcn1 UTSW 1 150627152 missense probably damaging 0.98
R1856:Hmcn1 UTSW 1 150721664 missense probably benign 0.02
R1859:Hmcn1 UTSW 1 150657193 missense probably damaging 1.00
R1862:Hmcn1 UTSW 1 150638900 missense probably benign 0.01
R1865:Hmcn1 UTSW 1 150603812 missense probably damaging 1.00
R1874:Hmcn1 UTSW 1 150720695 missense probably damaging 1.00
R1880:Hmcn1 UTSW 1 150638900 missense probably benign 0.01
R1881:Hmcn1 UTSW 1 150638900 missense probably benign 0.01
R1886:Hmcn1 UTSW 1 150577295 missense probably benign 0.02
R1888:Hmcn1 UTSW 1 150819500 missense possibly damaging 0.82
R1888:Hmcn1 UTSW 1 150819500 missense possibly damaging 0.82
R1899:Hmcn1 UTSW 1 150657451 missense probably damaging 1.00
R1905:Hmcn1 UTSW 1 150992855 missense probably damaging 1.00
R1912:Hmcn1 UTSW 1 150604882 missense probably benign 0.28
R1959:Hmcn1 UTSW 1 150649676 missense probably benign 0.00
R1960:Hmcn1 UTSW 1 150675991 missense probably benign 0.00
R1960:Hmcn1 UTSW 1 150677376 missense possibly damaging 0.72
R2001:Hmcn1 UTSW 1 150738613 missense possibly damaging 0.81
R2011:Hmcn1 UTSW 1 150677334 missense probably benign 0.01
R2075:Hmcn1 UTSW 1 150577323 missense possibly damaging 0.86
R2136:Hmcn1 UTSW 1 150633659 missense probably damaging 1.00
R2192:Hmcn1 UTSW 1 150715815 missense probably damaging 0.97
R2267:Hmcn1 UTSW 1 150599010 missense probably benign 0.00
R2268:Hmcn1 UTSW 1 150624598 splice site probably benign
R2303:Hmcn1 UTSW 1 150704226 missense probably damaging 1.00
R2330:Hmcn1 UTSW 1 150652678 splice site probably benign
R2338:Hmcn1 UTSW 1 150622934 missense possibly damaging 0.89
R2380:Hmcn1 UTSW 1 150565384 missense probably benign 0.01
R2405:Hmcn1 UTSW 1 150860341 missense probably damaging 1.00
R2443:Hmcn1 UTSW 1 150599032 missense probably benign 0.01
R2496:Hmcn1 UTSW 1 150615221 missense probably benign 0.01
R2504:Hmcn1 UTSW 1 150686867 nonsense probably null
R2519:Hmcn1 UTSW 1 150773820 nonsense probably null
R2520:Hmcn1 UTSW 1 150743647 missense possibly damaging 0.72
R2679:Hmcn1 UTSW 1 150652575 missense possibly damaging 0.67
R2831:Hmcn1 UTSW 1 150630652 critical splice donor site probably null
R2847:Hmcn1 UTSW 1 150563599 nonsense probably null
R2849:Hmcn1 UTSW 1 150563599 nonsense probably null
R2869:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2869:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2873:Hmcn1 UTSW 1 150738716 missense possibly damaging 0.95
R2897:Hmcn1 UTSW 1 150802873 missense probably damaging 1.00
R2905:Hmcn1 UTSW 1 150749035 missense probably damaging 1.00
R3498:Hmcn1 UTSW 1 150605102 missense probably damaging 0.98
R3499:Hmcn1 UTSW 1 150605102 missense probably damaging 0.98
R3724:Hmcn1 UTSW 1 150689518 missense possibly damaging 0.82
R3765:Hmcn1 UTSW 1 150745025 missense possibly damaging 0.72
R3778:Hmcn1 UTSW 1 150802824 missense possibly damaging 0.95
R3790:Hmcn1 UTSW 1 150622994 missense probably benign 0.09
R3796:Hmcn1 UTSW 1 150586418 missense probably damaging 1.00
R3811:Hmcn1 UTSW 1 150649577 critical splice donor site probably null
R3825:Hmcn1 UTSW 1 150586965 missense probably benign 0.28
R3890:Hmcn1 UTSW 1 150635195 missense probably damaging 1.00
R3891:Hmcn1 UTSW 1 150635195 missense probably damaging 1.00
R3892:Hmcn1 UTSW 1 150635195 missense probably damaging 1.00
R3918:Hmcn1 UTSW 1 150690610 missense probably benign 0.00
R3964:Hmcn1 UTSW 1 150573569 missense probably benign 0.00
R4005:Hmcn1 UTSW 1 150722453 missense possibly damaging 0.88
R4026:Hmcn1 UTSW 1 150722369 missense probably benign 0.03
R4037:Hmcn1 UTSW 1 150772502 missense probably benign 0.00
R4088:Hmcn1 UTSW 1 150703216 missense possibly damaging 0.58
R4096:Hmcn1 UTSW 1 150658508 missense probably benign 0.20
R4169:Hmcn1 UTSW 1 150595999 splice site probably null
R4441:Hmcn1 UTSW 1 150657459 missense probably null
R4493:Hmcn1 UTSW 1 150701899 missense probably damaging 1.00
R4501:Hmcn1 UTSW 1 150633666 missense probably damaging 1.00
R4535:Hmcn1 UTSW 1 150563780 missense probably damaging 0.99
R4576:Hmcn1 UTSW 1 150734487 missense probably benign
R4601:Hmcn1 UTSW 1 150738645 missense probably damaging 0.99
R4627:Hmcn1 UTSW 1 150595894 missense probably benign 0.11
R4647:Hmcn1 UTSW 1 150675511 critical splice donor site probably null
R4657:Hmcn1 UTSW 1 150624550 missense probably damaging 1.00
R4717:Hmcn1 UTSW 1 150619065 missense probably benign 0.00
R4721:Hmcn1 UTSW 1 150772571 splice site probably null
R4737:Hmcn1 UTSW 1 150689595 missense possibly damaging 0.90
R4744:Hmcn1 UTSW 1 150577612 missense probably damaging 1.00
R4795:Hmcn1 UTSW 1 150753611 missense probably benign 0.00
R4796:Hmcn1 UTSW 1 150753611 missense probably benign 0.00
R4871:Hmcn1 UTSW 1 150593085 missense probably benign 0.02
R4895:Hmcn1 UTSW 1 150677379 missense probably benign 0.00
R4934:Hmcn1 UTSW 1 150722535 missense probably damaging 1.00
R4953:Hmcn1 UTSW 1 150876360 intron probably benign
R4968:Hmcn1 UTSW 1 150657470 missense possibly damaging 0.67
R4974:Hmcn1 UTSW 1 150819449 missense probably benign 0.01
R5024:Hmcn1 UTSW 1 150680688 missense possibly damaging 0.65
R5031:Hmcn1 UTSW 1 150588257 missense probably damaging 1.00
R5093:Hmcn1 UTSW 1 150737256 missense probably benign 0.14
R5096:Hmcn1 UTSW 1 150610669 missense probably damaging 1.00
R5185:Hmcn1 UTSW 1 150656741 missense probably benign 0.03
R5228:Hmcn1 UTSW 1 150646701 missense probably benign 0.00
R5260:Hmcn1 UTSW 1 150595861 missense possibly damaging 0.65
R5264:Hmcn1 UTSW 1 150679514 missense probably benign 0.01
R5282:Hmcn1 UTSW 1 150582296 missense probably damaging 1.00
R5334:Hmcn1 UTSW 1 150755372 missense probably damaging 0.99
R5346:Hmcn1 UTSW 1 150623244 missense probably damaging 1.00
R5423:Hmcn1 UTSW 1 150701972 missense probably damaging 1.00
R5484:Hmcn1 UTSW 1 150675540 missense probably benign 0.00
R5491:Hmcn1 UTSW 1 150609825 splice site probably null
R5531:Hmcn1 UTSW 1 150743788 missense probably damaging 1.00
R5536:Hmcn1 UTSW 1 150755291 missense probably benign 0.01
R5547:Hmcn1 UTSW 1 150737506 missense possibly damaging 0.64
R5580:Hmcn1 UTSW 1 150577539 missense probably benign 0.43
R5626:Hmcn1 UTSW 1 150656567 missense probably damaging 1.00
R5657:Hmcn1 UTSW 1 150658562 missense probably benign 0.02
R5677:Hmcn1 UTSW 1 150609778 missense probably benign 0.00
R5718:Hmcn1 UTSW 1 150609666 missense probably damaging 1.00
R5718:Hmcn1 UTSW 1 150690600 nonsense probably null
R5723:Hmcn1 UTSW 1 150694849 missense possibly damaging 0.95
R5739:Hmcn1 UTSW 1 150758474 splice site probably null
R5739:Hmcn1 UTSW 1 150808697 missense probably benign 0.45
R5751:Hmcn1 UTSW 1 150573554 missense probably damaging 1.00
R5772:Hmcn1 UTSW 1 150694878 missense possibly damaging 0.47
R5804:Hmcn1 UTSW 1 150674347 nonsense probably null
R5809:Hmcn1 UTSW 1 150649607 missense probably damaging 1.00
R5817:Hmcn1 UTSW 1 150737524 missense possibly damaging 0.77
R5824:Hmcn1 UTSW 1 150993023 missense probably benign 0.12
R5881:Hmcn1 UTSW 1 150630327 missense probably damaging 0.99
R5928:Hmcn1 UTSW 1 150598897 missense possibly damaging 0.64
R5929:Hmcn1 UTSW 1 150577296 nonsense probably null
R5940:Hmcn1 UTSW 1 150657222 missense probably benign 0.41
R5973:Hmcn1 UTSW 1 150563817 missense probably damaging 1.00
R5997:Hmcn1 UTSW 1 150704173 missense possibly damaging 0.74
R6027:Hmcn1 UTSW 1 150802895 missense possibly damaging 0.79
R6029:Hmcn1 UTSW 1 150632437 missense probably benign 0.13
R6056:Hmcn1 UTSW 1 150663909 missense probably damaging 1.00
R6065:Hmcn1 UTSW 1 150770330 missense probably benign 0.06
R6083:Hmcn1 UTSW 1 150755293 missense probably damaging 1.00
R6083:Hmcn1 UTSW 1 150755294 missense probably damaging 1.00
R6108:Hmcn1 UTSW 1 150631227 missense possibly damaging 0.95
R6112:Hmcn1 UTSW 1 150618936 missense probably damaging 1.00
R6140:Hmcn1 UTSW 1 150732846 missense probably damaging 1.00
R6144:Hmcn1 UTSW 1 150722424 missense probably damaging 1.00
R6152:Hmcn1 UTSW 1 150565425 missense probably damaging 1.00
R6174:Hmcn1 UTSW 1 150646784 missense probably benign 0.06
R6185:Hmcn1 UTSW 1 150615438 intron probably null
R6187:Hmcn1 UTSW 1 150630728 missense probably damaging 1.00
R6276:Hmcn1 UTSW 1 150738681 missense possibly damaging 0.69
R6278:Hmcn1 UTSW 1 150697419 critical splice donor site probably null
R6427:Hmcn1 UTSW 1 150697476 missense possibly damaging 0.85
R6431:Hmcn1 UTSW 1 150744960 missense probably benign 0.01
R6441:Hmcn1 UTSW 1 150703216 missense possibly damaging 0.58
R6451:Hmcn1 UTSW 1 150992919 missense probably damaging 1.00
R6478:Hmcn1 UTSW 1 150664784 missense probably damaging 1.00
R6479:Hmcn1 UTSW 1 150677302 nonsense probably null
R6490:Hmcn1 UTSW 1 150583278 missense probably benign 0.00
R6525:Hmcn1 UTSW 1 150697566 missense probably damaging 1.00
R6571:Hmcn1 UTSW 1 150615438 intron probably null
R6612:Hmcn1 UTSW 1 150595118 critical splice donor site probably null
R6616:Hmcn1 UTSW 1 150723257 critical splice donor site probably null
R6617:Hmcn1 UTSW 1 150743796 missense probably benign 0.01
R6623:Hmcn1 UTSW 1 150758306 missense probably benign
R6687:Hmcn1 UTSW 1 150745033 missense probably benign 0.30
R6714:Hmcn1 UTSW 1 150704175 missense probably damaging 0.97
R6751:Hmcn1 UTSW 1 150734518 missense probably damaging 0.98
R6831:Hmcn1 UTSW 1 150770293 missense probably benign 0.00
R6971:Hmcn1 UTSW 1 150993051 start codon destroyed probably benign 0.00
R7048:Hmcn1 UTSW 1 150599653 critical splice acceptor site probably null
R7058:Hmcn1 UTSW 1 150773890 missense probably benign 0.43
R7071:Hmcn1 UTSW 1 150604102 missense probably damaging 1.00
R7078:Hmcn1 UTSW 1 150860367 missense probably damaging 1.00
R7092:Hmcn1 UTSW 1 150604246 missense probably damaging 1.00
R7120:Hmcn1 UTSW 1 150700541 missense probably damaging 0.98
R7144:Hmcn1 UTSW 1 150663873 missense probably damaging 1.00
R7148:Hmcn1 UTSW 1 150686854 missense probably benign 0.00
R7162:Hmcn1 UTSW 1 150748993 missense probably benign 0.18
R7172:Hmcn1 UTSW 1 150753699 missense possibly damaging 0.92
R7193:Hmcn1 UTSW 1 150649580 missense probably null 1.00
R7231:Hmcn1 UTSW 1 150638876 missense probably benign 0.00
R7237:Hmcn1 UTSW 1 150722643 missense probably damaging 0.98
R7258:Hmcn1 UTSW 1 150715823 missense probably benign 0.12
R7286:Hmcn1 UTSW 1 150582337 missense probably damaging 0.98
R7289:Hmcn1 UTSW 1 150683715 missense possibly damaging 0.52
R7316:Hmcn1 UTSW 1 150732946 missense probably damaging 1.00
X0022:Hmcn1 UTSW 1 150700530 missense probably benign 0.04
X0027:Hmcn1 UTSW 1 150860376 missense probably damaging 1.00
X0028:Hmcn1 UTSW 1 150663901 missense probably damaging 1.00
Z1088:Hmcn1 UTSW 1 150648937 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGAACCATGTCACAACG -3'
(R):5'- CTCTGCATTTCGATGGTCCATATG -3'

Sequencing Primer
(F):5'- TAACAGGTTTAGCTCAGGGCCTC -3'
(R):5'- CGATGGTCCATATGATGTTGAGAAG -3'
Posted On2016-06-28