Incidental Mutation 'R4488:Rnf122'
ID397251
Institutional Source Beutler Lab
Gene Symbol Rnf122
Ensembl Gene ENSMUSG00000039328
Gene Namering finger protein 122
Synonyms
MMRRC Submission 041744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4488 (G1)
Quality Score151
Status Validated
Chromosome8
Chromosomal Location31111820-31131482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31128255 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 92 (T92A)
Ref Sequence ENSEMBL: ENSMUSP00000150893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046941] [ENSMUST00000217278]
Predicted Effect probably damaging
Transcript: ENSMUST00000046941
AA Change: T91A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040478
Gene: ENSMUSG00000039328
AA Change: T91A

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
RING 92 132 3.64e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000217278
AA Change: T92A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.308 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The encoded protein contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. The encoded protein is localized to the endoplasmic reticulum and golgi apparatus, and may be associated with cell viability. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Alkal1 A T 1: 6,359,407 Q26L probably benign Het
Brox A G 1: 183,280,950 L280S probably benign Het
Cep41 A T 6: 30,655,689 probably benign Het
Cryz C A 3: 154,618,457 probably benign Het
Cyp26c1 T C 19: 37,693,210 V487A probably benign Het
Dlx6 T C 6: 6,867,207 M270T probably damaging Het
Glb1 T C 9: 114,443,114 I273T probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Hcrtr1 A G 4: 130,135,763 V175A probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kif1bp A G 10: 62,563,027 probably benign Het
Mki67 G A 7: 135,697,671 T1878I probably benign Het
Ncoa6 A G 2: 155,407,476 F1303L possibly damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nutf2 T A 8: 105,876,427 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Rbm45 T C 2: 76,376,396 S251P probably damaging Het
Rnaset2b A G 17: 6,998,070 Y155C probably damaging Het
Rnf220 A G 4: 117,489,814 S134P probably damaging Het
Shprh A T 10: 11,160,471 I351F probably benign Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Sulf1 G T 1: 12,786,515 probably benign Het
Svil T C 18: 5,049,067 Y202H probably damaging Het
Tek A G 4: 94,849,756 D681G possibly damaging Het
Tra2a A G 6: 49,252,494 probably benign Het
Vcp A T 4: 42,993,826 I102N probably damaging Het
Vmn2r25 A T 6: 123,822,860 I841N probably damaging Het
Zfp949 T C 9: 88,570,089 S571P probably damaging Het
Zkscan16 A G 4: 58,957,431 E571G possibly damaging Het
Zufsp G A 10: 33,948,964 T174I probably damaging Het
Other mutations in Rnf122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Rnf122 APN 8 31124880 nonsense probably null
IGL01545:Rnf122 APN 8 31128602 missense probably damaging 0.97
R0109:Rnf122 UTSW 8 31124849 splice site probably benign
R1263:Rnf122 UTSW 8 31112149 start codon destroyed probably null 0.01
R1961:Rnf122 UTSW 8 31124846 splice site probably benign
R2164:Rnf122 UTSW 8 31112164 nonsense probably null
R4369:Rnf122 UTSW 8 31112149 start codon destroyed probably null 0.00
R4964:Rnf122 UTSW 8 31112149 start codon destroyed probably null 0.00
R6983:Rnf122 UTSW 8 31118460 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGCTGCTATCCTGTCAGC -3'
(R):5'- TGCTGAACCTAGGCAGTCATTG -3'

Sequencing Primer
(F):5'- GTCAGCACAGTCTTGTAAATATGGC -3'
(R):5'- CCTAGGCAGTCATTGTTAAACAGC -3'
Posted On2016-06-29